Multiple sequence alignment - TraesCS2A01G241200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G241200 chr2A 100.000 2114 0 0 1 2114 335825985 335828098 0 3904
1 TraesCS2A01G241200 chr2A 97.354 718 16 3 1 717 276441367 276440652 0 1218
2 TraesCS2A01G241200 chr2A 98.713 544 6 1 1553 2096 588083887 588084429 0 965
3 TraesCS2A01G241200 chr1D 97.453 2120 29 7 1 2096 394178616 394180734 0 3592
4 TraesCS2A01G241200 chr1D 94.244 2050 86 12 67 2096 244443826 244445863 0 3103
5 TraesCS2A01G241200 chr3D 97.382 2101 39 7 1 2096 21897266 21899355 0 3561
6 TraesCS2A01G241200 chrUn 97.075 2120 34 8 1 2096 317473484 317471369 0 3546
7 TraesCS2A01G241200 chrUn 98.147 1187 15 5 1 1182 404957940 404959124 0 2063
8 TraesCS2A01G241200 chrUn 97.647 765 11 3 36 799 53261896 53261138 0 1306
9 TraesCS2A01G241200 chr3B 97.116 2115 37 6 1 2096 201506285 201508394 0 3546
10 TraesCS2A01G241200 chr6D 97.070 2116 34 7 1 2096 431399736 431401843 0 3539
11 TraesCS2A01G241200 chr6D 97.552 1307 12 4 810 2096 431403702 431402396 0 2218
12 TraesCS2A01G241200 chr6D 97.289 1033 8 9 1083 2096 431403693 431404724 0 1735
13 TraesCS2A01G241200 chr2D 96.408 2116 41 12 1 2096 334225631 334227731 0 3454
14 TraesCS2A01G241200 chr5D 97.372 1332 12 5 472 1780 554200515 554201846 0 2244
15 TraesCS2A01G241200 chr5D 97.427 1205 11 4 911 2096 554197429 554198632 0 2036
16 TraesCS2A01G241200 chr1A 98.069 777 10 2 1 776 256026461 256025689 0 1347
17 TraesCS2A01G241200 chr7D 95.249 842 31 5 1 841 88605295 88606128 0 1325
18 TraesCS2A01G241200 chr5A 98.074 675 11 2 1 674 684325294 684325967 0 1173


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G241200 chr2A 335825985 335828098 2113 False 3904 3904 100.0000 1 2114 1 chr2A.!!$F1 2113
1 TraesCS2A01G241200 chr2A 276440652 276441367 715 True 1218 1218 97.3540 1 717 1 chr2A.!!$R1 716
2 TraesCS2A01G241200 chr2A 588083887 588084429 542 False 965 965 98.7130 1553 2096 1 chr2A.!!$F2 543
3 TraesCS2A01G241200 chr1D 394178616 394180734 2118 False 3592 3592 97.4530 1 2096 1 chr1D.!!$F2 2095
4 TraesCS2A01G241200 chr1D 244443826 244445863 2037 False 3103 3103 94.2440 67 2096 1 chr1D.!!$F1 2029
5 TraesCS2A01G241200 chr3D 21897266 21899355 2089 False 3561 3561 97.3820 1 2096 1 chr3D.!!$F1 2095
6 TraesCS2A01G241200 chrUn 317471369 317473484 2115 True 3546 3546 97.0750 1 2096 1 chrUn.!!$R2 2095
7 TraesCS2A01G241200 chrUn 404957940 404959124 1184 False 2063 2063 98.1470 1 1182 1 chrUn.!!$F1 1181
8 TraesCS2A01G241200 chrUn 53261138 53261896 758 True 1306 1306 97.6470 36 799 1 chrUn.!!$R1 763
9 TraesCS2A01G241200 chr3B 201506285 201508394 2109 False 3546 3546 97.1160 1 2096 1 chr3B.!!$F1 2095
10 TraesCS2A01G241200 chr6D 431399736 431404724 4988 False 2637 3539 97.1795 1 2096 2 chr6D.!!$F1 2095
11 TraesCS2A01G241200 chr6D 431402396 431403702 1306 True 2218 2218 97.5520 810 2096 1 chr6D.!!$R1 1286
12 TraesCS2A01G241200 chr2D 334225631 334227731 2100 False 3454 3454 96.4080 1 2096 1 chr2D.!!$F1 2095
13 TraesCS2A01G241200 chr5D 554197429 554201846 4417 False 2140 2244 97.3995 472 2096 2 chr5D.!!$F1 1624
14 TraesCS2A01G241200 chr1A 256025689 256026461 772 True 1347 1347 98.0690 1 776 1 chr1A.!!$R1 775
15 TraesCS2A01G241200 chr7D 88605295 88606128 833 False 1325 1325 95.2490 1 841 1 chr7D.!!$F1 840
16 TraesCS2A01G241200 chr5A 684325294 684325967 673 False 1173 1173 98.0740 1 674 1 chr5A.!!$F1 673

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
87 88 0.179059 TCTTGACCAAACTGCGAGCA 60.179 50.0 0.0 0.0 0.0 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1292 6811 4.754618 TGAATGAAAGCGCTCTTAGTTCAA 59.245 37.5 21.52 6.56 30.85 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 88 0.179059 TCTTGACCAAACTGCGAGCA 60.179 50.000 0.00 0.0 0.00 4.26
231 235 8.470657 AAGTAAATTCAAGGAAGAGCTTTCTT 57.529 30.769 0.00 0.0 38.89 2.52
570 3186 7.327214 GGAATTAGGGACTCATGTATCATCTC 58.673 42.308 0.00 0.0 41.75 2.75
781 3414 4.018779 ACTGGCTGCTTTAACTATAACCCA 60.019 41.667 0.00 0.0 0.00 4.51
1292 6811 1.140375 GACCCGCGTTCTACCGAAT 59.860 57.895 4.92 0.0 0.00 3.34
1412 6931 7.664318 ACCCACTTTACTTTAATTGATCTCGTT 59.336 33.333 0.00 0.0 0.00 3.85
1629 7199 8.905660 TCTATCTATATATAGAACCCTCGTGC 57.094 38.462 23.08 0.0 42.20 5.34
1936 7507 3.006940 TCTATGGTTTGGTGCTTTAGCG 58.993 45.455 0.00 0.0 45.83 4.26
2096 7671 6.769134 TCGGAAGGAAAAAGAAAGAAAAGT 57.231 33.333 0.00 0.0 0.00 2.66
2097 7672 7.165460 TCGGAAGGAAAAAGAAAGAAAAGTT 57.835 32.000 0.00 0.0 0.00 2.66
2098 7673 7.608153 TCGGAAGGAAAAAGAAAGAAAAGTTT 58.392 30.769 0.00 0.0 0.00 2.66
2099 7674 7.758076 TCGGAAGGAAAAAGAAAGAAAAGTTTC 59.242 33.333 0.00 0.0 36.79 2.78
2100 7675 7.544217 CGGAAGGAAAAAGAAAGAAAAGTTTCA 59.456 33.333 6.56 0.0 38.66 2.69
2101 7676 9.383519 GGAAGGAAAAAGAAAGAAAAGTTTCAT 57.616 29.630 6.56 0.0 38.66 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 88 7.042335 CCCTATTTCATCTCGTAAAGTTCTGT 58.958 38.462 0.00 0.00 0.00 3.41
470 483 6.487299 AAGAACTAGATCATCTAACCCCAC 57.513 41.667 0.00 0.00 0.00 4.61
570 3186 8.571336 AGAAGTGTAAAAGAAAGTGGATTCATG 58.429 33.333 0.00 0.00 0.00 3.07
781 3414 7.394359 TCTTGTTCAAGCCAATAAATAGAGCTT 59.606 33.333 7.58 0.00 44.27 3.74
874 3507 4.220821 TCTGGAAAAGAGTCGTAGAATGCT 59.779 41.667 0.00 0.00 39.69 3.79
1241 6760 5.509163 CCGATGTCGTAGGTTCAAATCCTAT 60.509 44.000 1.44 0.00 39.36 2.57
1292 6811 4.754618 TGAATGAAAGCGCTCTTAGTTCAA 59.245 37.500 21.52 6.56 30.85 2.69
1412 6931 7.182817 TCTTTCTTCTTTATAGGCAGTAGCA 57.817 36.000 0.00 0.00 44.61 3.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.