Multiple sequence alignment - TraesCS2A01G241000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G241000 chr2A 100.000 2122 0 0 1 2122 335827670 335825549 0.000000e+00 3919
1 TraesCS2A01G241000 chr2A 96.137 1165 30 4 970 2121 276440652 276441814 0.000000e+00 1888
2 TraesCS2A01G241000 chr2A 97.761 134 2 1 1 134 588084019 588083887 1.640000e-56 230
3 TraesCS2A01G241000 chr1D 97.026 2152 33 8 1 2122 394180323 394178173 0.000000e+00 3591
4 TraesCS2A01G241000 chr1D 93.716 1639 74 10 1 1620 244445454 244443826 0.000000e+00 2429
5 TraesCS2A01G241000 chr1D 96.938 1045 10 4 1 1027 483921552 483922592 0.000000e+00 1733
6 TraesCS2A01G241000 chr6D 96.693 2147 38 7 1 2122 431401432 431399294 0.000000e+00 3541
7 TraesCS2A01G241000 chr6D 96.875 896 9 3 1 877 431402807 431403702 0.000000e+00 1482
8 TraesCS2A01G241000 chr3D 96.811 2132 47 8 1 2122 21898945 21896825 0.000000e+00 3541
9 TraesCS2A01G241000 chrUn 96.653 2121 38 8 1 2092 317471780 317473896 0.000000e+00 3493
10 TraesCS2A01G241000 chrUn 98.128 1389 19 5 505 1888 404959124 404957738 0.000000e+00 2414
11 TraesCS2A01G241000 chrUn 97.647 765 11 3 888 1651 53261138 53261896 0.000000e+00 1306
12 TraesCS2A01G241000 chr3B 96.238 2153 44 7 1 2121 201507984 201505837 0.000000e+00 3493
13 TraesCS2A01G241000 chr2D 95.682 2154 47 12 1 2122 334227322 334225183 0.000000e+00 3421
14 TraesCS2A01G241000 chr2D 97.834 1662 27 6 466 2122 628286598 628284941 0.000000e+00 2861
15 TraesCS2A01G241000 chr5D 96.215 1902 40 8 1 1883 6206417 6208305 0.000000e+00 3085
16 TraesCS2A01G241000 chr5D 97.173 1238 12 5 1 1215 554201752 554200515 0.000000e+00 2071
17 TraesCS2A01G241000 chr5D 96.599 794 8 3 1 776 554198221 554197429 0.000000e+00 1299
18 TraesCS2A01G241000 chr5D 99.020 102 1 0 1 102 420896184 420896083 1.290000e-42 183
19 TraesCS2A01G241000 chr1A 97.857 1213 20 3 911 2122 256025689 256026896 0.000000e+00 2091
20 TraesCS2A01G241000 chr5A 97.653 1108 23 3 1013 2119 684325967 684324862 0.000000e+00 1899
21 TraesCS2A01G241000 chr7D 94.330 1164 41 6 846 1992 88606128 88604973 0.000000e+00 1760


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G241000 chr2A 335825549 335827670 2121 True 3919 3919 100.000 1 2122 1 chr2A.!!$R1 2121
1 TraesCS2A01G241000 chr2A 276440652 276441814 1162 False 1888 1888 96.137 970 2121 1 chr2A.!!$F1 1151
2 TraesCS2A01G241000 chr1D 394178173 394180323 2150 True 3591 3591 97.026 1 2122 1 chr1D.!!$R2 2121
3 TraesCS2A01G241000 chr1D 244443826 244445454 1628 True 2429 2429 93.716 1 1620 1 chr1D.!!$R1 1619
4 TraesCS2A01G241000 chr1D 483921552 483922592 1040 False 1733 1733 96.938 1 1027 1 chr1D.!!$F1 1026
5 TraesCS2A01G241000 chr6D 431399294 431401432 2138 True 3541 3541 96.693 1 2122 1 chr6D.!!$R1 2121
6 TraesCS2A01G241000 chr6D 431402807 431403702 895 False 1482 1482 96.875 1 877 1 chr6D.!!$F1 876
7 TraesCS2A01G241000 chr3D 21896825 21898945 2120 True 3541 3541 96.811 1 2122 1 chr3D.!!$R1 2121
8 TraesCS2A01G241000 chrUn 317471780 317473896 2116 False 3493 3493 96.653 1 2092 1 chrUn.!!$F2 2091
9 TraesCS2A01G241000 chrUn 404957738 404959124 1386 True 2414 2414 98.128 505 1888 1 chrUn.!!$R1 1383
10 TraesCS2A01G241000 chrUn 53261138 53261896 758 False 1306 1306 97.647 888 1651 1 chrUn.!!$F1 763
11 TraesCS2A01G241000 chr3B 201505837 201507984 2147 True 3493 3493 96.238 1 2121 1 chr3B.!!$R1 2120
12 TraesCS2A01G241000 chr2D 334225183 334227322 2139 True 3421 3421 95.682 1 2122 1 chr2D.!!$R1 2121
13 TraesCS2A01G241000 chr2D 628284941 628286598 1657 True 2861 2861 97.834 466 2122 1 chr2D.!!$R2 1656
14 TraesCS2A01G241000 chr5D 6206417 6208305 1888 False 3085 3085 96.215 1 1883 1 chr5D.!!$F1 1882
15 TraesCS2A01G241000 chr5D 554197429 554201752 4323 True 1685 2071 96.886 1 1215 2 chr5D.!!$R2 1214
16 TraesCS2A01G241000 chr1A 256025689 256026896 1207 False 2091 2091 97.857 911 2122 1 chr1A.!!$F1 1211
17 TraesCS2A01G241000 chr5A 684324862 684325967 1105 True 1899 1899 97.653 1013 2119 1 chr5A.!!$R1 1106
18 TraesCS2A01G241000 chr7D 88604973 88606128 1155 True 1760 1760 94.330 846 1992 1 chr7D.!!$R1 1146

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
811 849 4.220821 TCTGGAAAAGAGTCGTAGAATGCT 59.779 41.667 0.0 0.0 39.69 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1806 3391 7.091443 TCTACTTACTTTTCAGTAGCTTCAGC 58.909 38.462 0.0 0.0 41.59 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
273 308 7.182817 TCTTTCTTCTTTATAGGCAGTAGCA 57.817 36.000 0.00 0.00 44.61 3.49
393 428 4.754618 TGAATGAAAGCGCTCTTAGTTCAA 59.245 37.500 21.52 6.56 30.85 2.69
444 479 5.509163 CCGATGTCGTAGGTTCAAATCCTAT 60.509 44.000 1.44 0.00 39.36 2.57
811 849 4.220821 TCTGGAAAAGAGTCGTAGAATGCT 59.779 41.667 0.00 0.00 39.69 3.79
904 942 7.394359 TCTTGTTCAAGCCAATAAATAGAGCTT 59.606 33.333 7.58 0.00 44.27 3.74
1115 1169 8.571336 AGAAGTGTAAAAGAAAGTGGATTCATG 58.429 33.333 0.00 0.00 0.00 3.07
1215 1269 6.487299 AAGAACTAGATCATCTAACCCCAC 57.513 41.667 0.00 0.00 0.00 4.61
1598 3182 7.042335 CCCTATTTCATCTCGTAAAGTTCTGT 58.958 38.462 0.00 0.00 0.00 3.41
1806 3391 8.812329 GCTGCTATTCCGAATTACTCTATTATG 58.188 37.037 0.00 0.00 0.00 1.90
1808 3393 8.531982 TGCTATTCCGAATTACTCTATTATGCT 58.468 33.333 0.00 0.00 0.00 3.79
1814 3399 6.870965 CCGAATTACTCTATTATGCTGAAGCT 59.129 38.462 3.61 0.00 42.66 3.74
1816 3401 8.855279 CGAATTACTCTATTATGCTGAAGCTAC 58.145 37.037 3.61 0.00 42.66 3.58
2053 4194 4.579454 TTCTATTTACTGGTCGATCCCG 57.421 45.455 0.00 0.00 34.77 5.14
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 8.905660 TCTATCTATATATAGAACCCTCGTGC 57.094 38.462 23.08 0.0 42.20 5.34
273 308 7.664318 ACCCACTTTACTTTAATTGATCTCGTT 59.336 33.333 0.00 0.0 0.00 3.85
393 428 1.140375 GACCCGCGTTCTACCGAAT 59.860 57.895 4.92 0.0 0.00 3.34
904 942 4.018779 ACTGGCTGCTTTAACTATAACCCA 60.019 41.667 0.00 0.0 0.00 4.51
1115 1169 7.327214 GGAATTAGGGACTCATGTATCATCTC 58.673 42.308 0.00 0.0 41.75 2.75
1598 3182 0.179059 TCTTGACCAAACTGCGAGCA 60.179 50.000 0.00 0.0 0.00 4.26
1806 3391 7.091443 TCTACTTACTTTTCAGTAGCTTCAGC 58.909 38.462 0.00 0.0 41.59 4.26
1808 3393 7.871463 GGTTCTACTTACTTTTCAGTAGCTTCA 59.129 37.037 0.00 0.0 41.59 3.02
2077 4292 9.625747 AACTCCCAAAATTTTTGTACATTCAAT 57.374 25.926 18.05 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.