Multiple sequence alignment - TraesCS2A01G232700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G232700 chr2A 100.000 2439 0 0 1 2439 276857833 276860271 0.000000e+00 4505
1 TraesCS2A01G232700 chr2A 91.967 722 39 9 1 709 109272615 109273330 0.000000e+00 994
2 TraesCS2A01G232700 chr2A 91.720 157 12 1 2278 2434 596774651 596774496 1.470000e-52 217
3 TraesCS2A01G232700 chr2A 90.446 157 14 1 2278 2434 131912320 131912165 3.180000e-49 206
4 TraesCS2A01G232700 chr3A 95.941 1823 56 3 634 2439 128659598 128657777 0.000000e+00 2940
5 TraesCS2A01G232700 chr3A 90.598 819 61 1 634 1436 381752590 381751772 0.000000e+00 1072
6 TraesCS2A01G232700 chr3A 95.639 665 17 6 1 654 550028668 550028005 0.000000e+00 1057
7 TraesCS2A01G232700 chr3A 91.645 754 45 7 1 737 39954389 39955141 0.000000e+00 1027
8 TraesCS2A01G232700 chr4A 95.440 1820 65 3 637 2439 566590024 566588206 0.000000e+00 2885
9 TraesCS2A01G232700 chr4A 95.087 1791 70 3 637 2410 566610726 566608937 0.000000e+00 2804
10 TraesCS2A01G232700 chr5A 93.812 1826 73 5 630 2439 136567984 136569785 0.000000e+00 2710
11 TraesCS2A01G232700 chr3B 92.227 1814 119 9 648 2439 367032886 367031073 0.000000e+00 2549
12 TraesCS2A01G232700 chr3B 92.113 1813 116 13 648 2438 379653319 379655126 0.000000e+00 2531
13 TraesCS2A01G232700 chr6B 92.188 1792 120 6 666 2439 129700708 129702497 0.000000e+00 2516
14 TraesCS2A01G232700 chr5B 90.780 1833 118 10 634 2439 328273367 328275175 0.000000e+00 2401
15 TraesCS2A01G232700 chr6D 92.026 1555 97 5 888 2439 17043132 17041602 0.000000e+00 2159
16 TraesCS2A01G232700 chr6D 95.751 659 17 7 1 648 434625860 434625202 0.000000e+00 1051
17 TraesCS2A01G232700 chr2D 95.796 666 16 6 1 654 351111091 351110426 0.000000e+00 1064
18 TraesCS2A01G232700 chr3D 96.177 654 14 5 1 643 357090839 357090186 0.000000e+00 1059
19 TraesCS2A01G232700 chr7D 95.599 659 18 5 1 648 550182147 550182805 0.000000e+00 1046
20 TraesCS2A01G232700 chr4D 95.296 659 20 5 1 648 92758109 92758767 0.000000e+00 1035
21 TraesCS2A01G232700 chr4D 94.017 117 7 0 634 750 277696419 277696535 6.930000e-41 178
22 TraesCS2A01G232700 chr1A 95.296 659 20 5 1 648 446980212 446980870 0.000000e+00 1035
23 TraesCS2A01G232700 chr6A 88.278 546 45 3 634 1160 214076432 214075887 9.510000e-179 636


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G232700 chr2A 276857833 276860271 2438 False 4505 4505 100.000 1 2439 1 chr2A.!!$F2 2438
1 TraesCS2A01G232700 chr2A 109272615 109273330 715 False 994 994 91.967 1 709 1 chr2A.!!$F1 708
2 TraesCS2A01G232700 chr3A 128657777 128659598 1821 True 2940 2940 95.941 634 2439 1 chr3A.!!$R1 1805
3 TraesCS2A01G232700 chr3A 381751772 381752590 818 True 1072 1072 90.598 634 1436 1 chr3A.!!$R2 802
4 TraesCS2A01G232700 chr3A 550028005 550028668 663 True 1057 1057 95.639 1 654 1 chr3A.!!$R3 653
5 TraesCS2A01G232700 chr3A 39954389 39955141 752 False 1027 1027 91.645 1 737 1 chr3A.!!$F1 736
6 TraesCS2A01G232700 chr4A 566588206 566590024 1818 True 2885 2885 95.440 637 2439 1 chr4A.!!$R1 1802
7 TraesCS2A01G232700 chr4A 566608937 566610726 1789 True 2804 2804 95.087 637 2410 1 chr4A.!!$R2 1773
8 TraesCS2A01G232700 chr5A 136567984 136569785 1801 False 2710 2710 93.812 630 2439 1 chr5A.!!$F1 1809
9 TraesCS2A01G232700 chr3B 367031073 367032886 1813 True 2549 2549 92.227 648 2439 1 chr3B.!!$R1 1791
10 TraesCS2A01G232700 chr3B 379653319 379655126 1807 False 2531 2531 92.113 648 2438 1 chr3B.!!$F1 1790
11 TraesCS2A01G232700 chr6B 129700708 129702497 1789 False 2516 2516 92.188 666 2439 1 chr6B.!!$F1 1773
12 TraesCS2A01G232700 chr5B 328273367 328275175 1808 False 2401 2401 90.780 634 2439 1 chr5B.!!$F1 1805
13 TraesCS2A01G232700 chr6D 17041602 17043132 1530 True 2159 2159 92.026 888 2439 1 chr6D.!!$R1 1551
14 TraesCS2A01G232700 chr6D 434625202 434625860 658 True 1051 1051 95.751 1 648 1 chr6D.!!$R2 647
15 TraesCS2A01G232700 chr2D 351110426 351111091 665 True 1064 1064 95.796 1 654 1 chr2D.!!$R1 653
16 TraesCS2A01G232700 chr3D 357090186 357090839 653 True 1059 1059 96.177 1 643 1 chr3D.!!$R1 642
17 TraesCS2A01G232700 chr7D 550182147 550182805 658 False 1046 1046 95.599 1 648 1 chr7D.!!$F1 647
18 TraesCS2A01G232700 chr4D 92758109 92758767 658 False 1035 1035 95.296 1 648 1 chr4D.!!$F1 647
19 TraesCS2A01G232700 chr1A 446980212 446980870 658 False 1035 1035 95.296 1 648 1 chr1A.!!$F1 647
20 TraesCS2A01G232700 chr6A 214075887 214076432 545 True 636 636 88.278 634 1160 1 chr6A.!!$R1 526

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
796 837 0.320771 GCGAGAAGTGGAAGGAGCAA 60.321 55.0 0.0 0.0 0.0 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2184 2237 6.128526 GGTCGTAAAATGAGAGAAGTCCAAAG 60.129 42.308 0.0 0.0 0.0 2.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 4.347583 AGGCAAGAAAACATCAATTTGGGA 59.652 37.500 0.00 0.00 0.00 4.37
564 577 8.601546 CAGAGAAAGATAGGGGCTTATAGATTT 58.398 37.037 0.00 0.00 0.00 2.17
785 826 3.706373 ATGGCGTGGGCGAGAAGT 61.706 61.111 0.00 0.00 41.24 3.01
796 837 0.320771 GCGAGAAGTGGAAGGAGCAA 60.321 55.000 0.00 0.00 0.00 3.91
965 1009 1.343465 ACCGAGCGGAAAAGAGAAGAA 59.657 47.619 16.83 0.00 38.96 2.52
1190 1234 4.918360 TGCTGGTGGTGGGGAGGT 62.918 66.667 0.00 0.00 0.00 3.85
1594 1638 6.114089 AGTTACTACTGCTCGATCTTCAGTA 58.886 40.000 13.98 13.98 40.96 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 0.032217 GGAGGCCCATCCCAAATTGA 60.032 55.000 0.00 0.0 32.79 2.57
63 64 8.354426 TGTTTATGGGCTTTACTAAACACTTTC 58.646 33.333 0.00 0.0 38.48 2.62
201 206 4.132336 CTGCTAGCATTCACACACCATAT 58.868 43.478 19.72 0.0 0.00 1.78
206 219 1.466167 CACCTGCTAGCATTCACACAC 59.534 52.381 19.72 0.0 0.00 3.82
207 220 1.812235 CACCTGCTAGCATTCACACA 58.188 50.000 19.72 0.0 0.00 3.72
564 577 1.074889 GAGGTAAAAGGTTGGGAGGCA 59.925 52.381 0.00 0.0 0.00 4.75
785 826 2.129555 GAGGCACCTTGCTCCTTCCA 62.130 60.000 0.00 0.0 44.28 3.53
842 883 0.033504 CCTGCGTGTGGACTTGTACT 59.966 55.000 0.00 0.0 0.00 2.73
1338 1382 2.922950 TTCCTCCCACCGACGAACG 61.923 63.158 0.00 0.0 42.18 3.95
1840 1888 7.387673 CCATTTCGTGATAACATCATAAGCCTA 59.612 37.037 0.00 0.0 42.04 3.93
2184 2237 6.128526 GGTCGTAAAATGAGAGAAGTCCAAAG 60.129 42.308 0.00 0.0 0.00 2.77


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.