Multiple sequence alignment - TraesCS2A01G232600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G232600 chr2A 100.000 2117 0 0 1 2117 276441206 276443322 0 3910
1 TraesCS2A01G232600 chr6D 97.546 2119 39 6 1 2117 431399897 431397790 0 3613
2 TraesCS2A01G232600 chr2D 97.452 2119 37 5 1 2117 628285536 628283433 0 3598
3 TraesCS2A01G232600 chr2D 97.151 1825 45 5 3 1826 334225790 334223972 0 3075
4 TraesCS2A01G232600 chr1D 97.120 2118 52 4 1 2117 254489568 254487459 0 3565
5 TraesCS2A01G232600 chr1D 94.521 2026 89 9 93 2117 244408392 244406388 0 3107
6 TraesCS2A01G232600 chr1D 94.423 2026 91 9 93 2117 244401941 244399937 0 3096
7 TraesCS2A01G232600 chr3D 96.931 2118 53 6 1 2117 21897426 21895320 0 3541
8 TraesCS2A01G232600 chr3B 96.464 2121 61 4 4 2117 201506443 201504330 0 3489
9 TraesCS2A01G232600 chr5D 96.571 2012 57 5 1 2004 329131837 329133844 0 3323
10 TraesCS2A01G232600 chr1A 97.136 1746 33 4 1 1746 256026300 256028028 0 2931
11 TraesCS2A01G232600 chr1A 96.797 1686 40 4 438 2117 554465594 554467271 0 2802
12 TraesCS2A01G232600 chrUn 97.759 580 7 1 1 580 317473323 317473896 0 994
13 TraesCS2A01G232600 chr7D 95.455 484 17 4 1 480 88605455 88604973 0 767


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G232600 chr2A 276441206 276443322 2116 False 3910 3910 100.000 1 2117 1 chr2A.!!$F1 2116
1 TraesCS2A01G232600 chr6D 431397790 431399897 2107 True 3613 3613 97.546 1 2117 1 chr6D.!!$R1 2116
2 TraesCS2A01G232600 chr2D 628283433 628285536 2103 True 3598 3598 97.452 1 2117 1 chr2D.!!$R2 2116
3 TraesCS2A01G232600 chr2D 334223972 334225790 1818 True 3075 3075 97.151 3 1826 1 chr2D.!!$R1 1823
4 TraesCS2A01G232600 chr1D 254487459 254489568 2109 True 3565 3565 97.120 1 2117 1 chr1D.!!$R3 2116
5 TraesCS2A01G232600 chr1D 244406388 244408392 2004 True 3107 3107 94.521 93 2117 1 chr1D.!!$R2 2024
6 TraesCS2A01G232600 chr1D 244399937 244401941 2004 True 3096 3096 94.423 93 2117 1 chr1D.!!$R1 2024
7 TraesCS2A01G232600 chr3D 21895320 21897426 2106 True 3541 3541 96.931 1 2117 1 chr3D.!!$R1 2116
8 TraesCS2A01G232600 chr3B 201504330 201506443 2113 True 3489 3489 96.464 4 2117 1 chr3B.!!$R1 2113
9 TraesCS2A01G232600 chr5D 329131837 329133844 2007 False 3323 3323 96.571 1 2004 1 chr5D.!!$F1 2003
10 TraesCS2A01G232600 chr1A 256026300 256028028 1728 False 2931 2931 97.136 1 1746 1 chr1A.!!$F1 1745
11 TraesCS2A01G232600 chr1A 554465594 554467271 1677 False 2802 2802 96.797 438 2117 1 chr1A.!!$F2 1679
12 TraesCS2A01G232600 chrUn 317473323 317473896 573 False 994 994 97.759 1 580 1 chrUn.!!$F1 579

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
91 92 1.568612 CGCGCTCACAGTTTGGTCAT 61.569 55.0 5.56 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1957 2017 1.198094 TTCGGAGGGATTGCAGGTCA 61.198 55.0 3.94 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 92 1.568612 CGCGCTCACAGTTTGGTCAT 61.569 55.000 5.56 0.00 0.00 3.06
266 268 4.996788 CCAAGATTTTGGCTGCTATTCT 57.003 40.909 1.44 0.00 46.84 2.40
443 473 2.634940 GCTGTGCCATAGGAAGGATAGA 59.365 50.000 0.00 0.00 0.00 1.98
543 574 7.606135 TTTCTATTTACTGGTCGATCCCATA 57.394 36.000 0.00 0.00 33.00 2.74
668 699 6.665992 TTCGATACTGGGTTATTCATAGCT 57.334 37.500 0.00 0.00 0.00 3.32
711 742 1.609555 TGCGGGTTGGTTATTTGTCAC 59.390 47.619 0.00 0.00 0.00 3.67
714 745 3.692593 GCGGGTTGGTTATTTGTCACTAT 59.307 43.478 0.00 0.00 0.00 2.12
801 832 6.057321 AGGAATTCCGTTAATAACTGACCA 57.943 37.500 18.82 0.00 42.08 4.02
1042 1074 9.866936 CGAATGAACAAAATGTTGAATTGAATT 57.133 25.926 1.62 0.00 41.28 2.17
1189 1221 5.908831 ACCATCCTTATAACTACCCATGACA 59.091 40.000 0.00 0.00 0.00 3.58
1224 1256 7.944061 TCTAGCATGACCAATTGATAAAATGG 58.056 34.615 7.12 0.00 38.91 3.16
1477 1517 6.480285 GCGGAATTTTTACTCTTATAACGCA 58.520 36.000 0.00 0.00 40.36 5.24
1761 1817 3.301274 TCACAAGAAATTTTTCCCCCGT 58.699 40.909 0.00 0.00 37.92 5.28
1821 1877 6.073765 GGCTAAACCTAAGCAAAAGAAAAAGC 60.074 38.462 0.00 0.00 41.93 3.51
1957 2017 5.196341 TGTGCCGAATAGACGATTAAGAT 57.804 39.130 0.00 0.00 35.09 2.40
2061 2121 9.182642 TGGGATATAAATAAGGAATTCCAGACT 57.817 33.333 26.22 10.01 38.89 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 92 7.776030 TGTTTGTTGGATTAGGTCTAACTTTCA 59.224 33.333 5.99 1.09 45.53 2.69
266 268 7.732025 TGGCTTCGGAATAATAGAGTAATTCA 58.268 34.615 0.00 0.00 32.42 2.57
581 612 3.446442 AGACATGCTGAACTCCCAAAT 57.554 42.857 0.00 0.00 0.00 2.32
668 699 7.876068 CGCAATGAATAGGGAAGGTATAGTAAA 59.124 37.037 0.00 0.00 0.00 2.01
711 742 5.357257 ACACGTCATAAGCTAAACCCATAG 58.643 41.667 0.00 0.00 0.00 2.23
714 745 3.688694 ACACGTCATAAGCTAAACCCA 57.311 42.857 0.00 0.00 0.00 4.51
801 832 9.831737 CATCGAGTTGTTCTAAAGAATCAAAAT 57.168 29.630 0.00 0.00 36.33 1.82
949 980 6.037062 TCGTTGGATGAACTACATTGCTAATG 59.963 38.462 7.16 7.16 39.56 1.90
952 983 5.079689 TCGTTGGATGAACTACATTGCTA 57.920 39.130 0.00 0.00 39.56 3.49
960 991 9.834628 GAATTTGTTTTATCGTTGGATGAACTA 57.165 29.630 0.00 0.00 34.14 2.24
1149 1181 3.500343 GATGGTATCCTTCCAAATGGGG 58.500 50.000 0.00 0.00 38.52 4.96
1189 1221 4.973168 TGGTCATGCTAGAGACAAAAACT 58.027 39.130 11.05 0.00 36.50 2.66
1224 1256 2.091830 CCATTTCCCCTACTTTCCTCCC 60.092 54.545 0.00 0.00 0.00 4.30
1274 1307 3.567397 ACCAGCTACAGTACCTATCAGG 58.433 50.000 0.00 0.00 42.49 3.86
1761 1817 6.552008 ACAAACAGAGGGGAAGAAAATATGA 58.448 36.000 0.00 0.00 0.00 2.15
1861 1921 7.871853 TCCTTTTTCTTCCTAATTCGTCAAAG 58.128 34.615 0.00 0.00 0.00 2.77
1862 1922 7.811117 TCCTTTTTCTTCCTAATTCGTCAAA 57.189 32.000 0.00 0.00 0.00 2.69
1863 1923 7.996098 ATCCTTTTTCTTCCTAATTCGTCAA 57.004 32.000 0.00 0.00 0.00 3.18
1864 1924 7.883311 AGAATCCTTTTTCTTCCTAATTCGTCA 59.117 33.333 0.00 0.00 31.94 4.35
1897 1957 9.483916 TTTTCTTGTGTCGATTCTTCTTGTATA 57.516 29.630 0.00 0.00 0.00 1.47
1957 2017 1.198094 TTCGGAGGGATTGCAGGTCA 61.198 55.000 3.94 0.00 0.00 4.02
2012 2072 4.473444 TGCAAAAGAAGAGAATCCAAGGT 58.527 39.130 0.00 0.00 33.66 3.50
2061 2121 9.730420 GTTTAGACTGCTTTTTGTTTATGAGAA 57.270 29.630 0.00 0.00 0.00 2.87


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.