Multiple sequence alignment - TraesCS2A01G232500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G232500 chr2A 100.000 2252 0 0 1 2252 276440802 276443053 0 4159
1 TraesCS2A01G232500 chr2A 96.140 2254 68 8 1 2252 335826552 335824316 0 3663
2 TraesCS2A01G232500 chr6D 97.116 2254 53 7 1 2252 431400299 431398056 0 3792
3 TraesCS2A01G232500 chr2D 97.029 2255 48 6 1 2252 628285941 628283703 0 3775
4 TraesCS2A01G232500 chr2D 97.131 2231 55 6 1 2230 334226194 334223972 0 3757
5 TraesCS2A01G232500 chr1D 96.894 2254 60 4 1 2252 254489974 254487729 0 3766
6 TraesCS2A01G232500 chr1D 96.541 1619 45 4 1 1614 394179185 394177573 0 2669
7 TraesCS2A01G232500 chr3B 96.459 2259 66 4 1 2252 201506850 201504599 0 3716
8 TraesCS2A01G232500 chr3D 96.362 2254 65 7 1 2252 21897828 21895590 0 3692
9 TraesCS2A01G232500 chr5D 96.106 2260 74 7 1 2251 329131433 329133687 0 3674
10 TraesCS2A01G232500 chr1A 97.072 2152 44 6 1 2150 256025894 256028028 0 3607
11 TraesCS2A01G232500 chrUn 96.457 988 25 3 1 984 317472915 317473896 0 1622
12 TraesCS2A01G232500 chr7D 94.932 888 40 4 1 884 88605859 88604973 0 1386


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G232500 chr2A 276440802 276443053 2251 False 4159 4159 100.000 1 2252 1 chr2A.!!$F1 2251
1 TraesCS2A01G232500 chr2A 335824316 335826552 2236 True 3663 3663 96.140 1 2252 1 chr2A.!!$R1 2251
2 TraesCS2A01G232500 chr6D 431398056 431400299 2243 True 3792 3792 97.116 1 2252 1 chr6D.!!$R1 2251
3 TraesCS2A01G232500 chr2D 628283703 628285941 2238 True 3775 3775 97.029 1 2252 1 chr2D.!!$R2 2251
4 TraesCS2A01G232500 chr2D 334223972 334226194 2222 True 3757 3757 97.131 1 2230 1 chr2D.!!$R1 2229
5 TraesCS2A01G232500 chr1D 254487729 254489974 2245 True 3766 3766 96.894 1 2252 1 chr1D.!!$R1 2251
6 TraesCS2A01G232500 chr1D 394177573 394179185 1612 True 2669 2669 96.541 1 1614 1 chr1D.!!$R2 1613
7 TraesCS2A01G232500 chr3B 201504599 201506850 2251 True 3716 3716 96.459 1 2252 1 chr3B.!!$R1 2251
8 TraesCS2A01G232500 chr3D 21895590 21897828 2238 True 3692 3692 96.362 1 2252 1 chr3D.!!$R1 2251
9 TraesCS2A01G232500 chr5D 329131433 329133687 2254 False 3674 3674 96.106 1 2251 1 chr5D.!!$F1 2250
10 TraesCS2A01G232500 chr1A 256025894 256028028 2134 False 3607 3607 97.072 1 2150 1 chr1A.!!$F1 2149
11 TraesCS2A01G232500 chrUn 317472915 317473896 981 False 1622 1622 96.457 1 984 1 chrUn.!!$F1 983
12 TraesCS2A01G232500 chr7D 88604973 88605859 886 True 1386 1386 94.932 1 884 1 chr7D.!!$R1 883

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
495 521 1.568612 CGCGCTCACAGTTTGGTCAT 61.569 55.0 5.56 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1628 1667 2.09183 CCATTTCCCCTACTTTCCTCCC 60.092 54.545 0.0 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 4.223953 TGATACATGAGTCCCTAGTTCCC 58.776 47.826 0.00 0.0 0.00 3.97
34 35 4.225267 GTCCCTAGTTCCCAATCAAGAGAA 59.775 45.833 0.00 0.0 0.00 2.87
495 521 1.568612 CGCGCTCACAGTTTGGTCAT 61.569 55.000 5.56 0.0 0.00 3.06
670 696 4.996788 CCAAGATTTTGGCTGCTATTCT 57.003 40.909 1.44 0.0 46.84 2.40
847 884 2.634940 GCTGTGCCATAGGAAGGATAGA 59.365 50.000 0.00 0.0 0.00 1.98
947 985 7.606135 TTTCTATTTACTGGTCGATCCCATA 57.394 36.000 0.00 0.0 33.00 2.74
1072 1110 6.665992 TTCGATACTGGGTTATTCATAGCT 57.334 37.500 0.00 0.0 0.00 3.32
1115 1153 1.609555 TGCGGGTTGGTTATTTGTCAC 59.390 47.619 0.00 0.0 0.00 3.67
1118 1156 3.692593 GCGGGTTGGTTATTTGTCACTAT 59.307 43.478 0.00 0.0 0.00 2.12
1205 1243 6.057321 AGGAATTCCGTTAATAACTGACCA 57.943 37.500 18.82 0.0 42.08 4.02
1446 1485 9.866936 CGAATGAACAAAATGTTGAATTGAATT 57.133 25.926 1.62 0.0 41.28 2.17
1593 1632 5.908831 ACCATCCTTATAACTACCCATGACA 59.091 40.000 0.00 0.0 0.00 3.58
1628 1667 7.944061 TCTAGCATGACCAATTGATAAAATGG 58.056 34.615 7.12 0.0 38.91 3.16
1881 1927 6.480285 GCGGAATTTTTACTCTTATAACGCA 58.520 36.000 0.00 0.0 40.36 5.24
2165 2223 3.301274 TCACAAGAAATTTTTCCCCCGT 58.699 40.909 0.00 0.0 37.92 5.28
2225 2283 6.073765 GGCTAAACCTAAGCAAAAGAAAAAGC 60.074 38.462 0.00 0.0 41.93 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 5.922544 CACAACAATTCTCTTGATTGGGAAC 59.077 40.000 0.00 0.00 0.00 3.62
23 24 8.492748 CAAATTCCACAACAATTCTCTTGATTG 58.507 33.333 0.00 0.00 0.00 2.67
34 35 7.274447 ACTCAATTGACAAATTCCACAACAAT 58.726 30.769 3.38 0.00 33.59 2.71
204 215 7.265599 TCACTCCAAAAAGAGGGTCATATTA 57.734 36.000 0.00 0.00 38.51 0.98
209 220 3.551846 GTTCACTCCAAAAAGAGGGTCA 58.448 45.455 0.00 0.00 38.51 4.02
495 521 7.776030 TGTTTGTTGGATTAGGTCTAACTTTCA 59.224 33.333 5.99 1.09 45.53 2.69
582 608 9.607333 TTAGGAAGGATATTCTCATACTGACAT 57.393 33.333 0.00 0.00 0.00 3.06
670 696 7.732025 TGGCTTCGGAATAATAGAGTAATTCA 58.268 34.615 0.00 0.00 32.42 2.57
985 1023 3.446442 AGACATGCTGAACTCCCAAAT 57.554 42.857 0.00 0.00 0.00 2.32
1072 1110 7.876068 CGCAATGAATAGGGAAGGTATAGTAAA 59.124 37.037 0.00 0.00 0.00 2.01
1115 1153 5.357257 ACACGTCATAAGCTAAACCCATAG 58.643 41.667 0.00 0.00 0.00 2.23
1118 1156 3.688694 ACACGTCATAAGCTAAACCCA 57.311 42.857 0.00 0.00 0.00 4.51
1205 1243 9.831737 CATCGAGTTGTTCTAAAGAATCAAAAT 57.168 29.630 0.00 0.00 36.33 1.82
1353 1391 6.037062 TCGTTGGATGAACTACATTGCTAATG 59.963 38.462 7.16 7.16 39.56 1.90
1364 1402 9.834628 GAATTTGTTTTATCGTTGGATGAACTA 57.165 29.630 0.00 0.00 34.14 2.24
1553 1592 3.500343 GATGGTATCCTTCCAAATGGGG 58.500 50.000 0.00 0.00 38.52 4.96
1593 1632 4.973168 TGGTCATGCTAGAGACAAAAACT 58.027 39.130 11.05 0.00 36.50 2.66
1628 1667 2.091830 CCATTTCCCCTACTTTCCTCCC 60.092 54.545 0.00 0.00 0.00 4.30
1678 1717 3.567397 ACCAGCTACAGTACCTATCAGG 58.433 50.000 0.00 0.00 42.49 3.86
2165 2223 6.552008 ACAAACAGAGGGGAAGAAAATATGA 58.448 36.000 0.00 0.00 0.00 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.