Multiple sequence alignment - TraesCS2A01G231100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G231100 chr2A 100.000 2836 0 0 1 2836 269269081 269266246 0.000000e+00 5238
1 TraesCS2A01G231100 chr2A 99.260 2838 19 2 1 2836 269306855 269304018 0.000000e+00 5123
2 TraesCS2A01G231100 chr3A 96.240 2580 95 1 1 2578 689755286 689752707 0.000000e+00 4226
3 TraesCS2A01G231100 chr3A 93.306 986 51 5 506 1479 298753033 298752051 0.000000e+00 1441
4 TraesCS2A01G231100 chr3A 86.151 1307 133 23 1155 2443 443960979 443962255 0.000000e+00 1367
5 TraesCS2A01G231100 chr3A 97.071 239 7 0 2340 2578 587439851 587440089 1.220000e-108 403
6 TraesCS2A01G231100 chr3A 95.238 252 12 0 2329 2580 561458319 561458570 1.580000e-107 399
7 TraesCS2A01G231100 chr3A 96.653 239 8 0 2340 2578 592133332 592133094 5.690000e-107 398
8 TraesCS2A01G231100 chr3A 97.034 236 7 0 2343 2578 687435601 687435366 5.690000e-107 398
9 TraesCS2A01G231100 chr3A 94.758 248 13 0 2332 2579 42398290 42398043 1.230000e-103 387
10 TraesCS2A01G231100 chr7A 95.371 2074 94 2 506 2578 95110074 95108002 0.000000e+00 3297
11 TraesCS2A01G231100 chr7A 95.584 385 14 2 1 383 199440348 199439965 5.190000e-172 614
12 TraesCS2A01G231100 chr7A 91.120 259 20 2 2578 2836 331365459 331365714 5.810000e-92 348
13 TraesCS2A01G231100 chr3B 89.721 2111 161 28 506 2579 639824423 639822332 0.000000e+00 2645
14 TraesCS2A01G231100 chr3B 88.605 2115 179 24 506 2578 790133655 790131561 0.000000e+00 2514
15 TraesCS2A01G231100 chr6B 89.474 1824 126 23 791 2578 557847081 557848874 0.000000e+00 2244
16 TraesCS2A01G231100 chr6B 86.531 1960 174 30 656 2578 449243195 449241289 0.000000e+00 2074
17 TraesCS2A01G231100 chr4B 94.481 1069 56 3 506 1574 669670354 669669289 0.000000e+00 1644
18 TraesCS2A01G231100 chr4B 86.877 1425 153 16 1158 2578 636652609 636651215 0.000000e+00 1565
19 TraesCS2A01G231100 chr1A 87.309 1442 137 20 1155 2579 530581911 530583323 0.000000e+00 1607
20 TraesCS2A01G231100 chr1A 86.727 1439 133 28 1158 2579 236300003 236298606 0.000000e+00 1546
21 TraesCS2A01G231100 chr2D 85.714 1442 146 27 1155 2580 512463007 512464404 0.000000e+00 1467
22 TraesCS2A01G231100 chr2D 92.996 257 17 1 2580 2836 286653867 286653612 9.590000e-100 374
23 TraesCS2A01G231100 chr2D 91.829 257 19 2 2580 2836 118348656 118348402 9.660000e-95 357
24 TraesCS2A01G231100 chr1B 85.421 1461 149 23 1155 2578 143194985 143196418 0.000000e+00 1459
25 TraesCS2A01G231100 chr1B 84.901 1159 128 25 1437 2578 129375926 129374798 0.000000e+00 1127
26 TraesCS2A01G231100 chr6A 91.495 1070 55 5 506 1574 576844097 576843063 0.000000e+00 1439
27 TraesCS2A01G231100 chr2B 92.622 637 45 1 710 1346 219710696 219711330 0.000000e+00 915
28 TraesCS2A01G231100 chr2B 89.453 256 15 3 506 761 219710459 219710702 2.120000e-81 313
29 TraesCS2A01G231100 chrUn 96.364 385 11 2 1 383 295944733 295944350 5.160000e-177 630
30 TraesCS2A01G231100 chrUn 97.688 346 8 0 1 346 265948179 265948524 1.880000e-166 595
31 TraesCS2A01G231100 chrUn 97.399 346 9 0 1 346 324062428 324062083 8.750000e-165 590
32 TraesCS2A01G231100 chrUn 97.598 333 8 0 14 346 378318513 378318845 3.170000e-159 571
33 TraesCS2A01G231100 chr4A 96.364 385 11 2 1 383 611288725 611289108 5.160000e-177 630
34 TraesCS2A01G231100 chr5A 96.562 320 9 1 1 320 698099126 698098809 1.930000e-146 529
35 TraesCS2A01G231100 chr7D 91.829 257 20 1 2580 2836 165471767 165471512 9.660000e-95 357
36 TraesCS2A01G231100 chr7D 91.440 257 20 2 2580 2836 424140704 424140958 4.500000e-93 351
37 TraesCS2A01G231100 chr7D 91.440 257 19 2 2580 2836 286697159 286696906 1.620000e-92 350
38 TraesCS2A01G231100 chr4D 91.440 257 20 2 2580 2836 52807556 52807810 4.500000e-93 351
39 TraesCS2A01G231100 chr3D 90.494 263 22 3 2575 2836 162316758 162316498 7.520000e-91 344


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G231100 chr2A 269266246 269269081 2835 True 5238 5238 100.0000 1 2836 1 chr2A.!!$R1 2835
1 TraesCS2A01G231100 chr2A 269304018 269306855 2837 True 5123 5123 99.2600 1 2836 1 chr2A.!!$R2 2835
2 TraesCS2A01G231100 chr3A 689752707 689755286 2579 True 4226 4226 96.2400 1 2578 1 chr3A.!!$R5 2577
3 TraesCS2A01G231100 chr3A 298752051 298753033 982 True 1441 1441 93.3060 506 1479 1 chr3A.!!$R2 973
4 TraesCS2A01G231100 chr3A 443960979 443962255 1276 False 1367 1367 86.1510 1155 2443 1 chr3A.!!$F1 1288
5 TraesCS2A01G231100 chr7A 95108002 95110074 2072 True 3297 3297 95.3710 506 2578 1 chr7A.!!$R1 2072
6 TraesCS2A01G231100 chr3B 639822332 639824423 2091 True 2645 2645 89.7210 506 2579 1 chr3B.!!$R1 2073
7 TraesCS2A01G231100 chr3B 790131561 790133655 2094 True 2514 2514 88.6050 506 2578 1 chr3B.!!$R2 2072
8 TraesCS2A01G231100 chr6B 557847081 557848874 1793 False 2244 2244 89.4740 791 2578 1 chr6B.!!$F1 1787
9 TraesCS2A01G231100 chr6B 449241289 449243195 1906 True 2074 2074 86.5310 656 2578 1 chr6B.!!$R1 1922
10 TraesCS2A01G231100 chr4B 669669289 669670354 1065 True 1644 1644 94.4810 506 1574 1 chr4B.!!$R2 1068
11 TraesCS2A01G231100 chr4B 636651215 636652609 1394 True 1565 1565 86.8770 1158 2578 1 chr4B.!!$R1 1420
12 TraesCS2A01G231100 chr1A 530581911 530583323 1412 False 1607 1607 87.3090 1155 2579 1 chr1A.!!$F1 1424
13 TraesCS2A01G231100 chr1A 236298606 236300003 1397 True 1546 1546 86.7270 1158 2579 1 chr1A.!!$R1 1421
14 TraesCS2A01G231100 chr2D 512463007 512464404 1397 False 1467 1467 85.7140 1155 2580 1 chr2D.!!$F1 1425
15 TraesCS2A01G231100 chr1B 143194985 143196418 1433 False 1459 1459 85.4210 1155 2578 1 chr1B.!!$F1 1423
16 TraesCS2A01G231100 chr1B 129374798 129375926 1128 True 1127 1127 84.9010 1437 2578 1 chr1B.!!$R1 1141
17 TraesCS2A01G231100 chr6A 576843063 576844097 1034 True 1439 1439 91.4950 506 1574 1 chr6A.!!$R1 1068
18 TraesCS2A01G231100 chr2B 219710459 219711330 871 False 614 915 91.0375 506 1346 2 chr2B.!!$F1 840

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
486 489 3.490761 GGGCATATGAACAATTTCGGGTG 60.491 47.826 6.97 0.0 34.04 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2201 2315 4.220382 TCAATTTTTGATCGGCTTCATGGT 59.78 37.5 0.0 0.0 34.08 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
486 489 3.490761 GGGCATATGAACAATTTCGGGTG 60.491 47.826 6.97 0.00 34.04 4.61
488 491 4.351192 GCATATGAACAATTTCGGGTGTC 58.649 43.478 6.97 0.00 34.04 3.67
537 540 3.501349 TGGACTGACTAAGCTTGAGTCT 58.499 45.455 24.11 13.29 43.19 3.24
2201 2315 1.113788 GCTGCAATAATGGGCTTGGA 58.886 50.000 0.00 0.00 0.00 3.53
2697 2831 1.344496 ACGAGGGAGAAGGGGATTCAT 60.344 52.381 0.00 0.00 40.67 2.57
2720 2854 3.305608 GCCTAGTGAAATGTTGCTGCTTT 60.306 43.478 0.00 0.00 0.00 3.51
2724 2858 2.796593 GTGAAATGTTGCTGCTTTGTCC 59.203 45.455 0.00 0.00 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
486 489 2.682155 TTTGCCCCAACACAAAAGAC 57.318 45.000 0.00 0.0 33.06 3.01
488 491 2.158842 TCCATTTGCCCCAACACAAAAG 60.159 45.455 0.00 0.0 39.09 2.27
2201 2315 4.220382 TCAATTTTTGATCGGCTTCATGGT 59.780 37.500 0.00 0.0 34.08 3.55
2697 2831 1.541147 GCAGCAACATTTCACTAGGCA 59.459 47.619 0.00 0.0 0.00 4.75
2720 2854 1.292223 GCAGTAAGCTGGACGGACA 59.708 57.895 3.75 0.0 42.78 4.02
2724 2858 0.798776 CTTTGGCAGTAAGCTGGACG 59.201 55.000 0.00 0.0 44.79 4.79
2807 2942 1.196012 CTGGAAGGTAGACTCACCCC 58.804 60.000 0.00 0.0 39.62 4.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.