Multiple sequence alignment - TraesCS2A01G225900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G225900 chr2A 100.000 2275 0 0 986 3260 232371213 232368939 0.000000e+00 4202
1 TraesCS2A01G225900 chr2A 100.000 435 0 0 1 435 232372198 232371764 0.000000e+00 804
2 TraesCS2A01G225900 chr2A 89.571 163 15 2 1215 1376 35976015 35976176 4.260000e-49 206
3 TraesCS2A01G225900 chr2D 96.513 2294 54 11 986 3260 203452531 203450245 0.000000e+00 3770
4 TraesCS2A01G225900 chr2D 91.441 444 4 10 1 435 203453027 203452609 2.180000e-161 579
5 TraesCS2A01G225900 chr2D 88.506 174 18 2 1204 1376 32763259 32763431 3.300000e-50 209
6 TraesCS2A01G225900 chr2B 95.397 2303 48 21 986 3260 257524446 257522174 0.000000e+00 3613
7 TraesCS2A01G225900 chr2B 91.762 437 16 13 1 430 257524947 257524524 1.010000e-164 590
8 TraesCS2A01G225900 chr2B 87.356 174 20 2 1204 1376 54440327 54440499 7.130000e-47 198
9 TraesCS2A01G225900 chr5B 89.714 175 15 1 1207 1378 112194704 112194530 1.520000e-53 220
10 TraesCS2A01G225900 chr5D 89.143 175 16 1 1207 1378 103175946 103175772 7.080000e-52 215
11 TraesCS2A01G225900 chr5A 89.143 175 16 1 1207 1378 95869236 95869410 7.080000e-52 215
12 TraesCS2A01G225900 chr7D 84.444 180 24 4 1196 1372 174992593 174992771 1.200000e-39 174


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G225900 chr2A 232368939 232372198 3259 True 2503.0 4202 100.0000 1 3260 2 chr2A.!!$R1 3259
1 TraesCS2A01G225900 chr2D 203450245 203453027 2782 True 2174.5 3770 93.9770 1 3260 2 chr2D.!!$R1 3259
2 TraesCS2A01G225900 chr2B 257522174 257524947 2773 True 2101.5 3613 93.5795 1 3260 2 chr2B.!!$R1 3259

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
334 345 2.027100 GGAAGGAAGGAAGTGTGGTAGG 60.027 54.545 0.0 0.0 0.0 3.18 F
1066 1077 2.092049 AGGAGATCAATTCATGGCTGCA 60.092 45.455 0.5 0.0 0.0 4.41 F
1867 1887 2.281761 GAGCACCACCACCACCAG 60.282 66.667 0.0 0.0 0.0 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1867 1887 1.153549 ATCGGTCGCCTTCTTCTGC 60.154 57.895 0.0 0.0 0.00 4.26 R
2174 2200 1.595794 ACAAGTTAACGACCAACGCAG 59.404 47.619 0.0 0.0 46.94 5.18 R
3044 3089 6.648725 ACTAAAAGTGAAGCAACTATAGCG 57.351 37.500 0.0 0.0 37.01 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 3.691118 AGCAACGCAAACATCATCAGTAT 59.309 39.130 0.00 0.00 0.00 2.12
41 42 4.031028 GCAACGCAAACATCATCAGTATC 58.969 43.478 0.00 0.00 0.00 2.24
334 345 2.027100 GGAAGGAAGGAAGTGTGGTAGG 60.027 54.545 0.00 0.00 0.00 3.18
1065 1076 2.553172 GAGGAGATCAATTCATGGCTGC 59.447 50.000 0.00 0.00 0.00 5.25
1066 1077 2.092049 AGGAGATCAATTCATGGCTGCA 60.092 45.455 0.50 0.00 0.00 4.41
1750 1770 2.970974 GCAGCACCTTCAAGACGGC 61.971 63.158 0.00 0.00 0.00 5.68
1867 1887 2.281761 GAGCACCACCACCACCAG 60.282 66.667 0.00 0.00 0.00 4.00
2057 2083 2.978946 ATGTACTGGGGCAACGGGG 61.979 63.158 0.00 0.00 37.60 5.73
2058 2084 4.419921 GTACTGGGGCAACGGGGG 62.420 72.222 0.00 0.00 37.60 5.40
2173 2199 1.448119 CTCGACGGATGGCTAGCTCA 61.448 60.000 15.72 11.42 0.00 4.26
2174 2200 1.299468 CGACGGATGGCTAGCTCAC 60.299 63.158 15.72 5.90 0.00 3.51
2239 2266 4.928020 CCGGTTAACTCTTTCCTTGACTAC 59.072 45.833 5.42 0.00 0.00 2.73
2346 2380 7.041098 TCAGAAAGCAGTTAGATCCAAAAAGAC 60.041 37.037 0.00 0.00 0.00 3.01
2440 2483 6.258727 GCCTTCAATCGATAATCAAGAAGACA 59.741 38.462 0.00 0.00 34.47 3.41
2554 2597 0.117140 TGCTTCTCCCTCTCCTTGGA 59.883 55.000 0.00 0.00 0.00 3.53
2660 2703 4.098654 GTGCAAGTAATGAGCCTCTCTCTA 59.901 45.833 0.00 0.00 42.38 2.43
2662 2705 6.015856 GTGCAAGTAATGAGCCTCTCTCTATA 60.016 42.308 0.00 0.00 42.38 1.31
2664 2707 7.890655 TGCAAGTAATGAGCCTCTCTCTATATA 59.109 37.037 0.00 0.00 42.38 0.86
2789 2832 6.099845 CCCCTGGAAGCTTAATTAGAGAACTA 59.900 42.308 0.00 0.00 0.00 2.24
2847 2891 5.000591 GGGTTTCTTCTTCCTTTCTCTCTG 58.999 45.833 0.00 0.00 0.00 3.35
3044 3089 3.786818 GCACGCATTCTATCAACTTGCTC 60.787 47.826 0.00 0.00 0.00 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
334 345 1.590932 ATTGCGAGCTGATGGTGATC 58.409 50.000 0.00 0.0 0.00 2.92
1035 1046 2.200092 GATCTCCTCCTCCGCCCT 59.800 66.667 0.00 0.0 0.00 5.19
1138 1155 2.833582 CCGGCCGAGGAAGAGCTA 60.834 66.667 30.73 0.0 0.00 3.32
1447 1467 1.226888 GGTAGACGACGTGATGCCC 60.227 63.158 4.58 0.0 0.00 5.36
1759 1779 1.630148 CGTAGAAGCCGTCAAAGAGG 58.370 55.000 0.00 0.0 0.00 3.69
1867 1887 1.153549 ATCGGTCGCCTTCTTCTGC 60.154 57.895 0.00 0.0 0.00 4.26
2174 2200 1.595794 ACAAGTTAACGACCAACGCAG 59.404 47.619 0.00 0.0 46.94 5.18
2263 2290 8.632679 CAGAGTATTCTCTCTCATCTTAGCTTT 58.367 37.037 0.00 0.0 46.84 3.51
2346 2380 4.093556 GCGAAAGAGAACAAACCCTATGAG 59.906 45.833 0.00 0.0 0.00 2.90
2554 2597 9.586732 ACACCATATGCCTTATATACAAAACAT 57.413 29.630 0.00 0.0 30.75 2.71
2660 2703 8.477256 GCCAAGATGAGAGAGAAAGCTATATAT 58.523 37.037 0.00 0.0 0.00 0.86
2662 2705 6.269538 TGCCAAGATGAGAGAGAAAGCTATAT 59.730 38.462 0.00 0.0 0.00 0.86
2664 2707 4.408270 TGCCAAGATGAGAGAGAAAGCTAT 59.592 41.667 0.00 0.0 0.00 2.97
2959 3004 7.166851 GGACTTGTATGAATCATCATCAGGAT 58.833 38.462 0.00 0.0 42.75 3.24
3044 3089 6.648725 ACTAAAAGTGAAGCAACTATAGCG 57.351 37.500 0.00 0.0 37.01 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.