Multiple sequence alignment - TraesCS2A01G224800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G224800 chr2A 100.000 3230 0 0 1 3230 226559355 226562584 0.000000e+00 5965
1 TraesCS2A01G224800 chr2B 98.824 3230 37 1 1 3230 133947525 133944297 0.000000e+00 5753
2 TraesCS2A01G224800 chr3B 98.067 2586 50 0 645 3230 661427604 661425019 0.000000e+00 4499
3 TraesCS2A01G224800 chr4A 98.417 2084 33 0 1147 3230 482406790 482408873 0.000000e+00 3666
4 TraesCS2A01G224800 chr5A 99.105 1006 9 0 2225 3230 502920214 502919209 0.000000e+00 1808
5 TraesCS2A01G224800 chr2D 78.434 1354 251 28 48 1388 516713722 516715047 0.000000e+00 845
6 TraesCS2A01G224800 chr6A 78.278 1289 237 22 48 1323 228526755 228528013 0.000000e+00 789
7 TraesCS2A01G224800 chr7D 77.721 1360 254 36 48 1388 51705949 51704620 0.000000e+00 787
8 TraesCS2A01G224800 chr4B 77.594 1330 250 32 60 1380 31126469 31125179 0.000000e+00 761
9 TraesCS2A01G224800 chr1B 77.252 1332 250 37 60 1380 493713185 493711896 0.000000e+00 732
10 TraesCS2A01G224800 chr7B 79.767 944 181 8 288 1226 541214822 541215760 0.000000e+00 676
11 TraesCS2A01G224800 chr7B 79.377 931 174 15 305 1226 444162763 444161842 9.770000e-180 640
12 TraesCS2A01G224800 chr6B 72.700 1674 387 58 1525 3163 281621596 281623234 2.240000e-136 496
13 TraesCS2A01G224800 chr6B 72.703 1110 259 32 1997 3085 431767257 431768343 6.680000e-87 331


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G224800 chr2A 226559355 226562584 3229 False 5965 5965 100.000 1 3230 1 chr2A.!!$F1 3229
1 TraesCS2A01G224800 chr2B 133944297 133947525 3228 True 5753 5753 98.824 1 3230 1 chr2B.!!$R1 3229
2 TraesCS2A01G224800 chr3B 661425019 661427604 2585 True 4499 4499 98.067 645 3230 1 chr3B.!!$R1 2585
3 TraesCS2A01G224800 chr4A 482406790 482408873 2083 False 3666 3666 98.417 1147 3230 1 chr4A.!!$F1 2083
4 TraesCS2A01G224800 chr5A 502919209 502920214 1005 True 1808 1808 99.105 2225 3230 1 chr5A.!!$R1 1005
5 TraesCS2A01G224800 chr2D 516713722 516715047 1325 False 845 845 78.434 48 1388 1 chr2D.!!$F1 1340
6 TraesCS2A01G224800 chr6A 228526755 228528013 1258 False 789 789 78.278 48 1323 1 chr6A.!!$F1 1275
7 TraesCS2A01G224800 chr7D 51704620 51705949 1329 True 787 787 77.721 48 1388 1 chr7D.!!$R1 1340
8 TraesCS2A01G224800 chr4B 31125179 31126469 1290 True 761 761 77.594 60 1380 1 chr4B.!!$R1 1320
9 TraesCS2A01G224800 chr1B 493711896 493713185 1289 True 732 732 77.252 60 1380 1 chr1B.!!$R1 1320
10 TraesCS2A01G224800 chr7B 541214822 541215760 938 False 676 676 79.767 288 1226 1 chr7B.!!$F1 938
11 TraesCS2A01G224800 chr7B 444161842 444162763 921 True 640 640 79.377 305 1226 1 chr7B.!!$R1 921
12 TraesCS2A01G224800 chr6B 281621596 281623234 1638 False 496 496 72.700 1525 3163 1 chr6B.!!$F1 1638
13 TraesCS2A01G224800 chr6B 431767257 431768343 1086 False 331 331 72.703 1997 3085 1 chr6B.!!$F2 1088

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
940 952 1.617947 GGGGCGAGTGGAAGAGATGT 61.618 60.0 0.0 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2528 2547 0.957395 GTGTGTGGTGGCCATCTCAG 60.957 60.0 20.84 0.0 35.28 3.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
940 952 1.617947 GGGGCGAGTGGAAGAGATGT 61.618 60.000 0.00 0.0 0.0 3.06
1345 1357 3.390521 CCCCGCAGACACAGCCTA 61.391 66.667 0.00 0.0 0.0 3.93
2552 2571 0.106268 ATGGCCACCACACACAAAGA 60.106 50.000 8.16 0.0 35.8 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 2.424842 ATCAGAAACCAGCGGGCCAA 62.425 55.000 4.39 0.0 37.90 4.52
1923 1935 2.269241 CGGGACTTTGGAGGAGCC 59.731 66.667 0.00 0.0 37.10 4.70
2376 2394 3.424703 AGCAGAACACAGCCAACATAAT 58.575 40.909 0.00 0.0 0.00 1.28
2528 2547 0.957395 GTGTGTGGTGGCCATCTCAG 60.957 60.000 20.84 0.0 35.28 3.35
2980 2999 9.045223 GTTTTTGCATTTTATTTCCTTCAGTCT 57.955 29.630 0.00 0.0 0.00 3.24
3091 3110 0.973496 AGCGAGAAGGAGGGGAAGAC 60.973 60.000 0.00 0.0 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.