Multiple sequence alignment - TraesCS2A01G211800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G211800 chr2A 100.000 2064 0 0 621 2684 196207959 196205896 0.000000e+00 3812
1 TraesCS2A01G211800 chr2A 100.000 256 0 0 1 256 196208579 196208324 8.700000e-130 473
2 TraesCS2A01G211800 chr4A 98.707 1315 16 1 621 1935 586502282 586500969 0.000000e+00 2333
3 TraesCS2A01G211800 chr4A 82.060 903 138 16 990 1886 456455932 456455048 0.000000e+00 749
4 TraesCS2A01G211800 chr4A 98.824 255 3 0 1 255 586502597 586502343 3.150000e-124 455
5 TraesCS2A01G211800 chr4D 92.165 1187 60 17 753 1935 14936039 14937196 0.000000e+00 1646
6 TraesCS2A01G211800 chr4D 81.707 902 142 15 990 1886 14857907 14858790 0.000000e+00 730
7 TraesCS2A01G211800 chr4D 81.657 905 142 19 990 1886 14862800 14863688 0.000000e+00 730
8 TraesCS2A01G211800 chr4D 81.021 901 155 11 990 1886 14914617 14915505 0.000000e+00 702
9 TraesCS2A01G211800 chr4D 80.989 910 149 15 990 1894 14459747 14458857 0.000000e+00 701
10 TraesCS2A01G211800 chr4D 88.112 143 16 1 1 143 14934492 14934633 4.600000e-38 169
11 TraesCS2A01G211800 chr1A 96.606 766 24 2 1920 2684 580102550 580103314 0.000000e+00 1269
12 TraesCS2A01G211800 chr2B 93.791 757 45 2 1929 2684 772538933 772539688 0.000000e+00 1136
13 TraesCS2A01G211800 chr2B 88.064 754 79 9 1929 2678 707151426 707150680 0.000000e+00 883
14 TraesCS2A01G211800 chr3B 91.808 769 58 5 1918 2684 564320743 564321508 0.000000e+00 1066
15 TraesCS2A01G211800 chr1B 91.413 757 62 3 1930 2684 209651461 209650706 0.000000e+00 1035
16 TraesCS2A01G211800 chr1B 90.438 753 68 4 1929 2678 635854855 635855606 0.000000e+00 989
17 TraesCS2A01G211800 chr1B 88.918 758 75 8 1930 2684 622375618 622374867 0.000000e+00 926
18 TraesCS2A01G211800 chr5B 89.333 750 72 7 1929 2675 694163310 694164054 0.000000e+00 935
19 TraesCS2A01G211800 chr4B 91.374 684 51 4 1254 1935 24919381 24918704 0.000000e+00 929
20 TraesCS2A01G211800 chr4B 81.618 952 146 22 990 1933 24741634 24742564 0.000000e+00 761
21 TraesCS2A01G211800 chr7B 88.507 757 76 9 1932 2684 538419713 538418964 0.000000e+00 905


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G211800 chr2A 196205896 196208579 2683 True 2142.5 3812 100.0000 1 2684 2 chr2A.!!$R1 2683
1 TraesCS2A01G211800 chr4A 586500969 586502597 1628 True 1394.0 2333 98.7655 1 1935 2 chr4A.!!$R2 1934
2 TraesCS2A01G211800 chr4A 456455048 456455932 884 True 749.0 749 82.0600 990 1886 1 chr4A.!!$R1 896
3 TraesCS2A01G211800 chr4D 14934492 14937196 2704 False 907.5 1646 90.1385 1 1935 2 chr4D.!!$F4 1934
4 TraesCS2A01G211800 chr4D 14857907 14858790 883 False 730.0 730 81.7070 990 1886 1 chr4D.!!$F1 896
5 TraesCS2A01G211800 chr4D 14862800 14863688 888 False 730.0 730 81.6570 990 1886 1 chr4D.!!$F2 896
6 TraesCS2A01G211800 chr4D 14914617 14915505 888 False 702.0 702 81.0210 990 1886 1 chr4D.!!$F3 896
7 TraesCS2A01G211800 chr4D 14458857 14459747 890 True 701.0 701 80.9890 990 1894 1 chr4D.!!$R1 904
8 TraesCS2A01G211800 chr1A 580102550 580103314 764 False 1269.0 1269 96.6060 1920 2684 1 chr1A.!!$F1 764
9 TraesCS2A01G211800 chr2B 772538933 772539688 755 False 1136.0 1136 93.7910 1929 2684 1 chr2B.!!$F1 755
10 TraesCS2A01G211800 chr2B 707150680 707151426 746 True 883.0 883 88.0640 1929 2678 1 chr2B.!!$R1 749
11 TraesCS2A01G211800 chr3B 564320743 564321508 765 False 1066.0 1066 91.8080 1918 2684 1 chr3B.!!$F1 766
12 TraesCS2A01G211800 chr1B 209650706 209651461 755 True 1035.0 1035 91.4130 1930 2684 1 chr1B.!!$R1 754
13 TraesCS2A01G211800 chr1B 635854855 635855606 751 False 989.0 989 90.4380 1929 2678 1 chr1B.!!$F1 749
14 TraesCS2A01G211800 chr1B 622374867 622375618 751 True 926.0 926 88.9180 1930 2684 1 chr1B.!!$R2 754
15 TraesCS2A01G211800 chr5B 694163310 694164054 744 False 935.0 935 89.3330 1929 2675 1 chr5B.!!$F1 746
16 TraesCS2A01G211800 chr4B 24918704 24919381 677 True 929.0 929 91.3740 1254 1935 1 chr4B.!!$R1 681
17 TraesCS2A01G211800 chr4B 24741634 24742564 930 False 761.0 761 81.6180 990 1933 1 chr4B.!!$F1 943
18 TraesCS2A01G211800 chr7B 538418964 538419713 749 True 905.0 905 88.5070 1932 2684 1 chr7B.!!$R1 752

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1482 2332 1.865788 GCGGCCTCATGCACTTTCAA 61.866 55.0 0.0 0.0 43.89 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2433 3300 1.597742 CTTGCGGCCATAGTAGCATT 58.402 50.0 2.24 0.0 39.5 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1479 2329 3.434319 CGCGGCCTCATGCACTTT 61.434 61.111 0.00 0.0 43.89 2.66
1482 2332 1.865788 GCGGCCTCATGCACTTTCAA 61.866 55.000 0.00 0.0 43.89 2.69
1560 2410 2.094659 CATCGTCTTCGTGCCGCTT 61.095 57.895 0.00 0.0 38.33 4.68
1624 2474 2.449967 TAAGGCTCTCCGGGTGGACA 62.450 60.000 0.00 0.0 40.17 4.02
1829 2690 8.597662 TGTAATACGATTGAATAAGTTAGCCC 57.402 34.615 0.00 0.0 0.00 5.19
1865 2729 2.803956 TCAAAACCGACACGAGGAATTC 59.196 45.455 0.00 0.0 0.00 2.17
2003 2867 1.873591 CTGAGGCAGCGTTTACAAAGT 59.126 47.619 0.00 0.0 0.00 2.66
2009 2873 3.120649 GGCAGCGTTTACAAAGTAGTCTG 60.121 47.826 0.00 0.0 0.00 3.51
2239 3106 1.402456 GCGAAGACGGTCTTGAGCTTA 60.402 52.381 26.87 0.0 36.73 3.09
2311 3178 5.865552 GCAGAAGAATGTTGCATTTGTACAT 59.134 36.000 0.00 0.0 37.75 2.29
2333 3200 2.024176 TGTTAGCAGGGTGAGAAGGA 57.976 50.000 0.00 0.0 0.00 3.36
2433 3300 3.963687 CTGCTGCCGCCAGTCATCA 62.964 63.158 0.00 0.0 41.26 3.07
2663 3530 4.551702 AAGTTGCCAAAAGAACACCTTT 57.448 36.364 0.00 0.0 46.47 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 3.011566 ACAAGGACACAACCACATCAA 57.988 42.857 0.00 0.0 0.00 2.57
154 155 4.381863 CACGTCCGAGTAATATTTCATCCG 59.618 45.833 0.00 0.0 0.00 4.18
701 1544 7.338449 AGAGAAGTGTATCCTGAGAACTAGAAC 59.662 40.741 0.00 0.0 0.00 3.01
1479 2329 0.533085 TGTCGCCGGTGTTGAATTGA 60.533 50.000 16.01 0.0 0.00 2.57
1482 2332 1.964373 GGTGTCGCCGGTGTTGAAT 60.964 57.895 16.01 0.0 0.00 2.57
1505 2355 3.855255 TGAAGGAGACAAACATGGTGA 57.145 42.857 5.73 0.0 0.00 4.02
1560 2410 2.437180 TCGGAGCCGAAGAGCGTA 60.437 61.111 9.50 0.0 46.01 4.42
1629 2479 2.036089 GGACTTGAGAAGTTCGACCACT 59.964 50.000 0.00 0.0 43.03 4.00
1829 2690 4.680237 TGACGGCCAGAACTGCGG 62.680 66.667 2.24 0.0 35.42 5.69
2009 2873 1.153997 GCTCGTTCCGTCTGTCCTC 60.154 63.158 0.00 0.0 0.00 3.71
2090 2957 5.131067 TGTAATAGACTCGCTATGGACTGT 58.869 41.667 0.00 0.0 39.73 3.55
2239 3106 4.515361 CAAGGATGCTGAGAGATTGAAGT 58.485 43.478 0.00 0.0 0.00 3.01
2311 3178 4.101114 TCCTTCTCACCCTGCTAACATTA 58.899 43.478 0.00 0.0 0.00 1.90
2333 3200 4.762289 ACTAGCAATCGAGGGAATCTTT 57.238 40.909 0.00 0.0 0.00 2.52
2433 3300 1.597742 CTTGCGGCCATAGTAGCATT 58.402 50.000 2.24 0.0 39.50 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.