Multiple sequence alignment - TraesCS2A01G211000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G211000 chr2A 100.000 2162 0 0 1 2162 194954967 194952806 0 3993
1 TraesCS2A01G211000 chr3B 98.429 2164 32 2 1 2162 201526512 201528675 0 3807
2 TraesCS2A01G211000 chr1A 98.429 2164 32 2 1 2162 554511736 554513899 0 3807
3 TraesCS2A01G211000 chr5D 98.383 2164 33 2 1 2162 503217706 503219869 0 3801
4 TraesCS2A01G211000 chr5D 98.059 2164 40 2 1 2162 503278738 503276575 0 3762
5 TraesCS2A01G211000 chr5D 97.874 2164 44 2 1 2162 6188428 6190591 0 3740
6 TraesCS2A01G211000 chr6D 98.198 2164 37 2 1 2162 168254414 168256577 0 3779
7 TraesCS2A01G211000 chr3D 98.198 2164 34 4 1 2162 589280054 589277894 0 3775
8 TraesCS2A01G211000 chr3A 97.921 2164 42 3 1 2162 672910519 672908357 0 3744
9 TraesCS2A01G211000 chr4A 96.072 2164 82 3 1 2162 309514619 309516781 0 3522


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G211000 chr2A 194952806 194954967 2161 True 3993 3993 100.000 1 2162 1 chr2A.!!$R1 2161
1 TraesCS2A01G211000 chr3B 201526512 201528675 2163 False 3807 3807 98.429 1 2162 1 chr3B.!!$F1 2161
2 TraesCS2A01G211000 chr1A 554511736 554513899 2163 False 3807 3807 98.429 1 2162 1 chr1A.!!$F1 2161
3 TraesCS2A01G211000 chr5D 503217706 503219869 2163 False 3801 3801 98.383 1 2162 1 chr5D.!!$F2 2161
4 TraesCS2A01G211000 chr5D 503276575 503278738 2163 True 3762 3762 98.059 1 2162 1 chr5D.!!$R1 2161
5 TraesCS2A01G211000 chr5D 6188428 6190591 2163 False 3740 3740 97.874 1 2162 1 chr5D.!!$F1 2161
6 TraesCS2A01G211000 chr6D 168254414 168256577 2163 False 3779 3779 98.198 1 2162 1 chr6D.!!$F1 2161
7 TraesCS2A01G211000 chr3D 589277894 589280054 2160 True 3775 3775 98.198 1 2162 1 chr3D.!!$R1 2161
8 TraesCS2A01G211000 chr3A 672908357 672910519 2162 True 3744 3744 97.921 1 2162 1 chr3A.!!$R1 2161
9 TraesCS2A01G211000 chr4A 309514619 309516781 2162 False 3522 3522 96.072 1 2162 1 chr4A.!!$F1 2161

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
523 524 0.90158 AAGGGACGCTTCCGGTTCTA 60.902 55.0 0.0 0.0 43.94 2.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1450 1454 1.069978 GAACTCAGAGCATAGGAGGGC 59.93 57.143 0.0 0.0 32.98 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
470 471 4.789012 TTTGCCTCTGACCATCAAATTC 57.211 40.909 0.00 0.00 0.00 2.17
509 510 3.073062 CCTCCTCTCTTTGAAACAAGGGA 59.927 47.826 0.00 0.00 0.00 4.20
523 524 0.901580 AAGGGACGCTTCCGGTTCTA 60.902 55.000 0.00 0.00 43.94 2.10
636 638 4.304110 CTGCCGTTACTCAACAGTTTCTA 58.696 43.478 0.00 0.00 34.05 2.10
860 864 2.121948 TCTCTTCTCACCATCCCCATG 58.878 52.381 0.00 0.00 0.00 3.66
978 982 1.271379 CGGTATAGGCGCTTATGACCA 59.729 52.381 21.14 0.00 0.00 4.02
1093 1097 1.414919 TCACTTGCCTGTCTACGGTTT 59.585 47.619 0.00 0.00 0.00 3.27
1356 1360 8.103305 TGCTTTATTTCTGTCTTAGTGAATCCT 58.897 33.333 0.00 0.00 0.00 3.24
1450 1454 6.866010 TGATTCCATCCATAAATCGACTTG 57.134 37.500 0.00 0.00 33.13 3.16
1578 1582 4.749820 TGAGATTCCATGGATAGAGAGCT 58.250 43.478 17.06 8.21 0.00 4.09
1800 1804 5.352569 GGCAAATATTCGGAGATGACTATGG 59.647 44.000 0.00 0.00 35.04 2.74
2087 2092 7.657354 TCATTATCAGACAATCACTTATTCCCG 59.343 37.037 0.00 0.00 0.00 5.14
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 127 6.238648 GCTTTGGAAGAAGCTTGTACAGTTTA 60.239 38.462 2.10 0.00 46.55 2.01
240 241 4.927049 TCAGCAGATTTGGATTCCTTTCT 58.073 39.130 3.95 0.99 0.00 2.52
415 416 2.502538 CAGTGGTAATTAAGACCCCCGA 59.497 50.000 6.83 0.00 35.99 5.14
470 471 2.943033 GGAGGACGGGTTATTCACATTG 59.057 50.000 0.00 0.00 0.00 2.82
509 510 1.518572 CGCATAGAACCGGAAGCGT 60.519 57.895 9.46 0.00 40.25 5.07
523 524 3.870419 ACAAAATTGTTTGAAGCACGCAT 59.130 34.783 6.21 0.00 45.99 4.73
636 638 3.140519 ACCTCTACGGGATAGACCTCAAT 59.859 47.826 0.00 0.00 34.80 2.57
860 864 6.624352 ATGCATACATTTGTCTCATACACC 57.376 37.500 0.00 0.00 38.00 4.16
978 982 2.746375 CGCAAGGCATAGAGGGGGT 61.746 63.158 0.00 0.00 0.00 4.95
1093 1097 4.680237 CCCGAGCACACGCAAGGA 62.680 66.667 0.00 0.00 46.39 3.36
1197 1201 5.104693 ACGTATGATCATTACCCTTCAACCA 60.105 40.000 14.65 0.00 0.00 3.67
1450 1454 1.069978 GAACTCAGAGCATAGGAGGGC 59.930 57.143 0.00 0.00 32.98 5.19
1578 1582 9.832445 GAACATTCCATAAGTCTATTGGAACTA 57.168 33.333 15.27 0.00 40.85 2.24
1800 1804 2.159170 CGAGGATCCAGAGAGGTGTTTC 60.159 54.545 15.82 0.00 39.02 2.78
1896 1901 9.323985 GCTAAAGAGAAATGATCACTATGAGTT 57.676 33.333 0.00 0.00 0.00 3.01
2087 2092 2.734492 CGATTAGTCCCACACGAGGTTC 60.734 54.545 0.00 0.00 0.00 3.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.