Multiple sequence alignment - TraesCS2A01G190600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G190600 chr2A 100.000 2399 0 0 1 2399 157465767 157463369 0 4431
1 TraesCS2A01G190600 chr2A 97.833 2400 44 3 1 2399 176093080 176095472 0 4137
2 TraesCS2A01G190600 chr2A 96.625 2400 76 4 1 2399 690774447 690776842 0 3978
3 TraesCS2A01G190600 chr3A 97.583 2400 56 2 1 2399 91419911 91417513 0 4109
4 TraesCS2A01G190600 chr3A 96.628 2402 76 5 1 2399 612179843 612177444 0 3982
5 TraesCS2A01G190600 chr3A 96.625 2400 75 6 1 2399 392190441 392188047 0 3978
6 TraesCS2A01G190600 chr7A 96.747 2398 75 3 4 2399 371392128 371389732 0 3993
7 TraesCS2A01G190600 chr7A 96.668 2401 77 3 1 2399 417903655 417901256 0 3988
8 TraesCS2A01G190600 chr7A 96.626 2401 78 3 1 2399 409916959 409914560 0 3982
9 TraesCS2A01G190600 chr4A 96.588 2403 75 5 1 2399 169726237 169723838 0 3976


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G190600 chr2A 157463369 157465767 2398 True 4431 4431 100.000 1 2399 1 chr2A.!!$R1 2398
1 TraesCS2A01G190600 chr2A 176093080 176095472 2392 False 4137 4137 97.833 1 2399 1 chr2A.!!$F1 2398
2 TraesCS2A01G190600 chr2A 690774447 690776842 2395 False 3978 3978 96.625 1 2399 1 chr2A.!!$F2 2398
3 TraesCS2A01G190600 chr3A 91417513 91419911 2398 True 4109 4109 97.583 1 2399 1 chr3A.!!$R1 2398
4 TraesCS2A01G190600 chr3A 612177444 612179843 2399 True 3982 3982 96.628 1 2399 1 chr3A.!!$R3 2398
5 TraesCS2A01G190600 chr3A 392188047 392190441 2394 True 3978 3978 96.625 1 2399 1 chr3A.!!$R2 2398
6 TraesCS2A01G190600 chr7A 371389732 371392128 2396 True 3993 3993 96.747 4 2399 1 chr7A.!!$R1 2395
7 TraesCS2A01G190600 chr7A 417901256 417903655 2399 True 3988 3988 96.668 1 2399 1 chr7A.!!$R3 2398
8 TraesCS2A01G190600 chr7A 409914560 409916959 2399 True 3982 3982 96.626 1 2399 1 chr7A.!!$R2 2398
9 TraesCS2A01G190600 chr4A 169723838 169726237 2399 True 3976 3976 96.588 1 2399 1 chr4A.!!$R1 2398

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
841 845 0.400213 AGGAAGGACGTTCATGCCAA 59.6 50.0 9.9 0.0 36.82 4.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2351 2360 0.759346 GCTACCTACTCCATGGGTGG 59.241 60.0 13.02 10.55 43.35 4.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
270 274 9.545105 AATGTTAATGTTGCAGATTTTTCAGAA 57.455 25.926 0.0 0.0 0.00 3.02
472 476 2.674796 AAATCCTCCGAGTACTGTGC 57.325 50.000 0.0 0.0 0.00 4.57
545 549 1.334160 TTGAGGTCTGGTCGCTACAA 58.666 50.000 0.0 0.0 0.00 2.41
581 585 0.598562 CACGCTGACTGTAGGACACT 59.401 55.000 0.0 0.0 0.00 3.55
841 845 0.400213 AGGAAGGACGTTCATGCCAA 59.600 50.000 9.9 0.0 36.82 4.52
919 923 2.110967 GCAGCTCACATCGCCATGT 61.111 57.895 0.0 0.0 44.72 3.21
1369 1373 2.808523 TGAAGCAGGAGCAGATATCG 57.191 50.000 0.0 0.0 45.49 2.92
1379 1383 4.013728 GGAGCAGATATCGTGGAGTCTAT 58.986 47.826 0.0 0.0 0.00 1.98
1456 1460 6.769341 TGTAAATATAGTAGTCCGAGCACTCA 59.231 38.462 0.0 0.0 0.00 3.41
2006 2015 0.322816 GCCCATGTTTCAGCAGGAGA 60.323 55.000 0.0 0.0 0.00 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
270 274 6.098017 CGACCTAAAAACTCCTTAATCGTCT 58.902 40.000 0.00 0.00 0.00 4.18
545 549 2.739932 GCGTGTGCTCTGATACCATCTT 60.740 50.000 0.00 0.00 38.39 2.40
581 585 7.284944 GTGATCTAGGTCTTTAGCTTAGTGGTA 59.715 40.741 4.28 0.00 34.60 3.25
841 845 4.472833 AGAAAACTCTATGGGCTCAGTGAT 59.527 41.667 0.00 0.00 0.00 3.06
919 923 2.094182 GGTAGACTTCTCCAATGCGTCA 60.094 50.000 0.00 0.00 0.00 4.35
949 953 9.386122 ACAAATCTGGTAGATAGTATCCTTGAT 57.614 33.333 6.53 2.20 32.89 2.57
1369 1373 9.623350 GAAATATTCTACGGTTATAGACTCCAC 57.377 37.037 0.00 0.00 30.75 4.02
1456 1460 4.585955 ACAATCGGTCTAACTATCGCAT 57.414 40.909 0.00 0.00 0.00 4.73
1631 1636 0.615331 GATCAACTGGGTGAGCTCCA 59.385 55.000 12.15 1.22 31.14 3.86
2006 2015 1.203052 CACGCTTCTTCATGGCCATTT 59.797 47.619 17.92 0.00 0.00 2.32
2215 2224 7.095910 CCTTCAATCATAAGAGCACGATCTAT 58.904 38.462 0.00 0.00 0.00 1.98
2341 2350 1.203288 TCCATGGGTGGGCTGAAAATT 60.203 47.619 13.02 0.00 46.06 1.82
2351 2360 0.759346 GCTACCTACTCCATGGGTGG 59.241 60.000 13.02 10.55 43.35 4.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.