Multiple sequence alignment - TraesCS2A01G188300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G188300 chr2A 100.000 2589 0 0 1 2589 152005267 152002679 0.000000e+00 4782
1 TraesCS2A01G188300 chr4A 97.728 2597 51 4 1 2589 584413575 584410979 0.000000e+00 4462
2 TraesCS2A01G188300 chr3A 97.614 2598 53 5 1 2589 734137503 734134906 0.000000e+00 4446
3 TraesCS2A01G188300 chr3A 97.112 2597 66 5 1 2589 18252312 18249717 0.000000e+00 4372
4 TraesCS2A01G188300 chr3A 97.500 2440 48 7 158 2589 550991819 550994253 0.000000e+00 4156
5 TraesCS2A01G188300 chr3A 86.215 1625 199 16 979 2586 706253112 706254728 0.000000e+00 1736
6 TraesCS2A01G188300 chr3A 97.516 161 4 0 1 161 550978245 550978405 2.540000e-70 276
7 TraesCS2A01G188300 chr6A 97.383 2598 45 7 1 2589 5066990 5069573 0.000000e+00 4399
8 TraesCS2A01G188300 chr5D 89.266 1649 126 17 979 2589 432138392 432136757 0.000000e+00 2017
9 TraesCS2A01G188300 chr5D 86.838 699 60 13 1914 2589 14576372 14575683 0.000000e+00 752
10 TraesCS2A01G188300 chr5D 84.660 691 76 17 1 666 432139506 432138821 0.000000e+00 662
11 TraesCS2A01G188300 chr5D 83.750 320 31 11 664 973 432138744 432138436 1.520000e-72 283
12 TraesCS2A01G188300 chr3B 86.057 1628 203 16 979 2589 3118209 3116589 0.000000e+00 1727
13 TraesCS2A01G188300 chr3B 81.085 682 95 17 7 666 3119445 3118776 4.940000e-142 514
14 TraesCS2A01G188300 chr1D 90.657 1263 92 9 1339 2589 13203606 13202358 0.000000e+00 1655
15 TraesCS2A01G188300 chr1D 85.180 695 72 16 1 666 13204442 13203750 0.000000e+00 684
16 TraesCS2A01G188300 chr1D 87.654 324 36 3 1 323 316630969 316630649 8.750000e-100 374
17 TraesCS2A01G188300 chr6D 82.151 465 43 18 664 1096 325708939 325708483 1.890000e-96 363
18 TraesCS2A01G188300 chr6B 77.476 515 110 5 1018 1531 183306185 183306694 1.160000e-78 303


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G188300 chr2A 152002679 152005267 2588 True 4782.000000 4782 100.0000 1 2589 1 chr2A.!!$R1 2588
1 TraesCS2A01G188300 chr4A 584410979 584413575 2596 True 4462.000000 4462 97.7280 1 2589 1 chr4A.!!$R1 2588
2 TraesCS2A01G188300 chr3A 734134906 734137503 2597 True 4446.000000 4446 97.6140 1 2589 1 chr3A.!!$R2 2588
3 TraesCS2A01G188300 chr3A 18249717 18252312 2595 True 4372.000000 4372 97.1120 1 2589 1 chr3A.!!$R1 2588
4 TraesCS2A01G188300 chr3A 550991819 550994253 2434 False 4156.000000 4156 97.5000 158 2589 1 chr3A.!!$F2 2431
5 TraesCS2A01G188300 chr3A 706253112 706254728 1616 False 1736.000000 1736 86.2150 979 2586 1 chr3A.!!$F3 1607
6 TraesCS2A01G188300 chr6A 5066990 5069573 2583 False 4399.000000 4399 97.3830 1 2589 1 chr6A.!!$F1 2588
7 TraesCS2A01G188300 chr5D 432136757 432139506 2749 True 987.333333 2017 85.8920 1 2589 3 chr5D.!!$R2 2588
8 TraesCS2A01G188300 chr5D 14575683 14576372 689 True 752.000000 752 86.8380 1914 2589 1 chr5D.!!$R1 675
9 TraesCS2A01G188300 chr3B 3116589 3119445 2856 True 1120.500000 1727 83.5710 7 2589 2 chr3B.!!$R1 2582
10 TraesCS2A01G188300 chr1D 13202358 13204442 2084 True 1169.500000 1655 87.9185 1 2589 2 chr1D.!!$R2 2588
11 TraesCS2A01G188300 chr6B 183306185 183306694 509 False 303.000000 303 77.4760 1018 1531 1 chr6B.!!$F1 513

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
156 165 0.597637 CGCACAGGAAACAGAGTCGT 60.598 55.0 0.0 0.0 0.0 4.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1832 2244 0.749649 CTAGCTGGTCGAGGATTGCT 59.25 55.0 0.0 0.0 34.92 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
156 165 0.597637 CGCACAGGAAACAGAGTCGT 60.598 55.000 0.00 0.0 0.00 4.34
203 215 3.253188 GCTGTCTCCTATCTCTAGCACTG 59.747 52.174 0.00 0.0 0.00 3.66
260 272 3.875134 CGAACCCTAGATTATTTTGGCGT 59.125 43.478 0.00 0.0 0.00 5.68
356 386 1.617804 CCATCCACACAAGGGCTTGAT 60.618 52.381 0.00 0.0 42.93 2.57
375 405 2.603075 TGACCAGAAATTTGGGGGAG 57.397 50.000 0.00 0.0 42.76 4.30
985 1394 3.071602 TCTGGAGCCCTAATATGCACTTC 59.928 47.826 0.00 0.0 0.00 3.01
1061 1470 6.485648 CAGATGAAGGCATATCTCATTGAACA 59.514 38.462 0.00 0.0 34.11 3.18
1206 1615 4.013050 AGCAAAAGGAGCAGGATCTAAAC 58.987 43.478 0.00 0.0 0.00 2.01
1586 1998 2.158534 TCACCACAACAACAAGGGCTAT 60.159 45.455 0.00 0.0 0.00 2.97
1617 2029 1.305201 CACACACCTACACCAACCAC 58.695 55.000 0.00 0.0 0.00 4.16
1832 2244 7.040132 TGCATGAAATTCCACAAGTTGTACATA 60.040 33.333 8.49 0.0 0.00 2.29
2398 2839 3.119029 GCATTACTGGGCACATGATTGTT 60.119 43.478 0.00 0.0 32.34 2.83
2473 2914 7.701924 TCTTTCTGCAGTGTTTGACAAAAATAG 59.298 33.333 14.67 0.0 0.00 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
156 165 1.705873 GAGATAGAAAGGAGGGGCGA 58.294 55.000 0.00 0.0 0.00 5.54
260 272 1.075212 TGGTGCTCCATGTTGATTCCA 59.925 47.619 2.64 0.0 39.03 3.53
356 386 1.077005 CCTCCCCCAAATTTCTGGTCA 59.923 52.381 0.00 0.0 34.33 4.02
393 423 2.053747 AGGGTTGGATGGTTACCTCA 57.946 50.000 2.07 0.0 32.46 3.86
488 520 6.084277 GTGACCTATTTTCGTTTTAAGCCTG 58.916 40.000 0.00 0.0 0.00 4.85
873 1235 8.730680 GTGGTATTGAAGGCAGGTAATATATTG 58.269 37.037 8.28 0.0 0.00 1.90
985 1394 7.043961 TCTTAGACATACCTAGCAACATGAG 57.956 40.000 0.00 0.0 0.00 2.90
1061 1470 6.566079 TGGGAACATCATGATCTCTTAACT 57.434 37.500 4.86 0.0 33.40 2.24
1515 1927 6.083630 TGAGTTGCTTTGTTCGCATAATAAC 58.916 36.000 0.00 0.0 37.22 1.89
1617 2029 2.118313 TGAATCACCAGGAGCATGTG 57.882 50.000 0.00 0.0 0.00 3.21
1832 2244 0.749649 CTAGCTGGTCGAGGATTGCT 59.250 55.000 0.00 0.0 34.92 3.91
2026 2438 2.224548 CGAAAGACCCTCCAACCTTTCT 60.225 50.000 0.00 0.0 41.15 2.52
2194 2610 7.729124 TTTAAAGGTAGCACTCACCTAGTAT 57.271 36.000 0.00 0.0 45.90 2.12
2417 2858 6.183360 GCTTTAAGAGCCATTTAACATTGCAC 60.183 38.462 0.00 0.0 46.01 4.57
2473 2914 9.298774 GTTGTACTGTACTCCACTTAATATGAC 57.701 37.037 17.98 0.0 0.00 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.