Multiple sequence alignment - TraesCS2A01G180300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G180300 chr2A 100.000 2720 0 0 1 2720 139131583 139134302 0.000000e+00 5024
1 TraesCS2A01G180300 chr2A 93.788 1320 78 3 666 1983 139077550 139078867 0.000000e+00 1980
2 TraesCS2A01G180300 chr2A 97.577 743 18 0 1978 2720 139139805 139140547 0.000000e+00 1273
3 TraesCS2A01G180300 chr2A 92.989 271 17 1 666 934 247134941 247135211 7.060000e-106 394
4 TraesCS2A01G180300 chr2A 90.406 271 23 2 666 934 247122122 247122391 1.200000e-93 353
5 TraesCS2A01G180300 chr2A 91.111 180 15 1 753 932 388501179 388501001 2.710000e-60 243
6 TraesCS2A01G180300 chr4A 93.101 1319 88 3 666 1983 14309647 14308331 0.000000e+00 1929
7 TraesCS2A01G180300 chr4A 92.489 1318 95 4 666 1983 14301671 14300358 0.000000e+00 1882
8 TraesCS2A01G180300 chr4A 85.227 176 21 2 1803 1976 368551804 368551632 2.780000e-40 176
9 TraesCS2A01G180300 chr4A 86.335 161 14 6 1790 1949 417997401 417997248 4.660000e-38 169
10 TraesCS2A01G180300 chr4A 90.244 123 7 4 673 792 420999954 421000074 3.630000e-34 156
11 TraesCS2A01G180300 chr1A 97.174 743 21 0 1978 2720 394881828 394882570 0.000000e+00 1256
12 TraesCS2A01G180300 chr1A 97.170 742 21 0 1978 2719 251429176 251429917 0.000000e+00 1254
13 TraesCS2A01G180300 chr1A 96.904 743 23 0 1978 2720 361305531 361304789 0.000000e+00 1245
14 TraesCS2A01G180300 chr1A 96.900 742 23 0 1978 2719 329512840 329513581 0.000000e+00 1243
15 TraesCS2A01G180300 chr1A 96.896 741 23 0 1978 2718 151116135 151116875 0.000000e+00 1242
16 TraesCS2A01G180300 chr1A 99.549 665 3 0 1 665 67002046 67002710 0.000000e+00 1212
17 TraesCS2A01G180300 chr1A 90.027 732 70 3 915 1644 351722102 351721372 0.000000e+00 944
18 TraesCS2A01G180300 chr1A 90.854 656 58 2 915 1569 351713379 351712725 0.000000e+00 878
19 TraesCS2A01G180300 chr1A 84.746 295 34 7 1622 1911 107011481 107011193 4.430000e-73 285
20 TraesCS2A01G180300 chr1A 90.860 186 16 1 749 934 509445726 509445910 5.820000e-62 248
21 TraesCS2A01G180300 chr1A 90.588 170 13 3 749 918 509453641 509453807 3.530000e-54 222
22 TraesCS2A01G180300 chr6A 97.039 743 22 0 1978 2720 215643862 215644604 0.000000e+00 1251
23 TraesCS2A01G180300 chr6A 97.039 743 22 0 1978 2720 457525714 457524972 0.000000e+00 1251
24 TraesCS2A01G180300 chr6A 91.892 111 5 3 666 773 121830851 121830742 4.690000e-33 152
25 TraesCS2A01G180300 chr6A 90.991 111 6 3 666 773 121822974 121822865 2.180000e-31 147
26 TraesCS2A01G180300 chr6A 89.189 111 8 3 666 773 121815114 121815005 4.720000e-28 135
27 TraesCS2A01G180300 chr5A 96.787 747 24 0 1974 2720 309938221 309938967 0.000000e+00 1247
28 TraesCS2A01G180300 chr5A 84.887 311 37 7 1622 1928 576365766 576366070 3.400000e-79 305
29 TraesCS2A01G180300 chr5A 95.722 187 8 0 748 934 441410984 441410798 4.400000e-78 302
30 TraesCS2A01G180300 chr7A 99.553 671 3 0 1 671 499574548 499573878 0.000000e+00 1223
31 TraesCS2A01G180300 chr7A 91.257 732 59 5 915 1643 490042046 490041317 0.000000e+00 992
32 TraesCS2A01G180300 chr7A 90.314 733 65 6 915 1644 490049861 490049132 0.000000e+00 955
33 TraesCS2A01G180300 chr7A 90.251 718 69 1 915 1632 109562525 109561809 0.000000e+00 937
34 TraesCS2A01G180300 chr7A 90.497 684 62 3 920 1603 385102833 385102153 0.000000e+00 900
35 TraesCS2A01G180300 chr7A 85.792 183 21 3 1803 1983 338698997 338698818 3.580000e-44 189
36 TraesCS2A01G180300 chr7A 85.093 161 17 5 1790 1949 509973897 509973743 1.010000e-34 158
37 TraesCS2A01G180300 chr7A 80.711 197 27 6 1790 1983 282493764 282493952 2.820000e-30 143
38 TraesCS2A01G180300 chr3B 99.700 666 2 0 1 666 54314634 54315299 0.000000e+00 1219
39 TraesCS2A01G180300 chr2B 99.550 667 2 1 1 667 157363685 157363020 0.000000e+00 1214
40 TraesCS2A01G180300 chr2B 99.400 667 4 0 1 667 384103931 384104597 0.000000e+00 1210
41 TraesCS2A01G180300 chr5B 99.549 665 3 0 1 665 473811796 473811132 0.000000e+00 1212
42 TraesCS2A01G180300 chr5B 99.548 663 3 0 1 663 471417871 471418533 0.000000e+00 1208
43 TraesCS2A01G180300 chr1B 99.400 667 4 0 1 667 117191676 117191010 0.000000e+00 1210
44 TraesCS2A01G180300 chr1B 99.399 666 4 0 1 666 190316574 190317239 0.000000e+00 1208
45 TraesCS2A01G180300 chr7D 93.939 165 10 0 1622 1786 482361655 482361491 1.620000e-62 250
46 TraesCS2A01G180300 chr2D 93.939 165 10 0 1622 1786 228988587 228988751 1.620000e-62 250
47 TraesCS2A01G180300 chr6D 93.333 165 11 0 1622 1786 43364940 43365104 7.520000e-61 244
48 TraesCS2A01G180300 chr6D 93.333 165 11 0 1622 1786 43373112 43373276 7.520000e-61 244
49 TraesCS2A01G180300 chr3A 87.075 147 14 4 1804 1949 168008305 168008447 7.790000e-36 161
50 TraesCS2A01G180300 chr3A 98.333 60 1 0 1549 1608 188733525 188733584 3.700000e-19 106
51 TraesCS2A01G180300 chr3A 91.781 73 6 0 1536 1608 188725484 188725556 4.790000e-18 102


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G180300 chr2A 139131583 139134302 2719 False 5024 5024 100.000 1 2720 1 chr2A.!!$F2 2719
1 TraesCS2A01G180300 chr2A 139077550 139078867 1317 False 1980 1980 93.788 666 1983 1 chr2A.!!$F1 1317
2 TraesCS2A01G180300 chr2A 139139805 139140547 742 False 1273 1273 97.577 1978 2720 1 chr2A.!!$F3 742
3 TraesCS2A01G180300 chr4A 14308331 14309647 1316 True 1929 1929 93.101 666 1983 1 chr4A.!!$R2 1317
4 TraesCS2A01G180300 chr4A 14300358 14301671 1313 True 1882 1882 92.489 666 1983 1 chr4A.!!$R1 1317
5 TraesCS2A01G180300 chr1A 394881828 394882570 742 False 1256 1256 97.174 1978 2720 1 chr1A.!!$F5 742
6 TraesCS2A01G180300 chr1A 251429176 251429917 741 False 1254 1254 97.170 1978 2719 1 chr1A.!!$F3 741
7 TraesCS2A01G180300 chr1A 361304789 361305531 742 True 1245 1245 96.904 1978 2720 1 chr1A.!!$R4 742
8 TraesCS2A01G180300 chr1A 329512840 329513581 741 False 1243 1243 96.900 1978 2719 1 chr1A.!!$F4 741
9 TraesCS2A01G180300 chr1A 151116135 151116875 740 False 1242 1242 96.896 1978 2718 1 chr1A.!!$F2 740
10 TraesCS2A01G180300 chr1A 67002046 67002710 664 False 1212 1212 99.549 1 665 1 chr1A.!!$F1 664
11 TraesCS2A01G180300 chr1A 351721372 351722102 730 True 944 944 90.027 915 1644 1 chr1A.!!$R3 729
12 TraesCS2A01G180300 chr1A 351712725 351713379 654 True 878 878 90.854 915 1569 1 chr1A.!!$R2 654
13 TraesCS2A01G180300 chr6A 215643862 215644604 742 False 1251 1251 97.039 1978 2720 1 chr6A.!!$F1 742
14 TraesCS2A01G180300 chr6A 457524972 457525714 742 True 1251 1251 97.039 1978 2720 1 chr6A.!!$R4 742
15 TraesCS2A01G180300 chr5A 309938221 309938967 746 False 1247 1247 96.787 1974 2720 1 chr5A.!!$F1 746
16 TraesCS2A01G180300 chr7A 499573878 499574548 670 True 1223 1223 99.553 1 671 1 chr7A.!!$R6 670
17 TraesCS2A01G180300 chr7A 490041317 490042046 729 True 992 992 91.257 915 1643 1 chr7A.!!$R4 728
18 TraesCS2A01G180300 chr7A 490049132 490049861 729 True 955 955 90.314 915 1644 1 chr7A.!!$R5 729
19 TraesCS2A01G180300 chr7A 109561809 109562525 716 True 937 937 90.251 915 1632 1 chr7A.!!$R1 717
20 TraesCS2A01G180300 chr7A 385102153 385102833 680 True 900 900 90.497 920 1603 1 chr7A.!!$R3 683
21 TraesCS2A01G180300 chr3B 54314634 54315299 665 False 1219 1219 99.700 1 666 1 chr3B.!!$F1 665
22 TraesCS2A01G180300 chr2B 157363020 157363685 665 True 1214 1214 99.550 1 667 1 chr2B.!!$R1 666
23 TraesCS2A01G180300 chr2B 384103931 384104597 666 False 1210 1210 99.400 1 667 1 chr2B.!!$F1 666
24 TraesCS2A01G180300 chr5B 473811132 473811796 664 True 1212 1212 99.549 1 665 1 chr5B.!!$R1 664
25 TraesCS2A01G180300 chr5B 471417871 471418533 662 False 1208 1208 99.548 1 663 1 chr5B.!!$F1 662
26 TraesCS2A01G180300 chr1B 117191010 117191676 666 True 1210 1210 99.400 1 667 1 chr1B.!!$R1 666
27 TraesCS2A01G180300 chr1B 190316574 190317239 665 False 1208 1208 99.399 1 666 1 chr1B.!!$F1 665

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
245 246 1.806568 CGCAGTTGGTGTGGTTTGT 59.193 52.632 0.0 0.0 32.53 2.83 F
1248 1249 2.528127 TGCCCGAACCCTCAAGGA 60.528 61.111 0.0 0.0 39.89 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1546 1549 0.999406 CTTGTCGGATTCGCGACATT 59.001 50.0 22.29 0.0 43.34 2.71 R
2162 2170 2.488167 CCATTGTACTGGGTGTGTTGGA 60.488 50.0 0.00 0.0 32.28 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
245 246 1.806568 CGCAGTTGGTGTGGTTTGT 59.193 52.632 0.00 0.00 32.53 2.83
512 513 8.683615 TCATGTTCGTTTACTCATGAGTATAGT 58.316 33.333 31.03 12.45 42.83 2.12
723 724 3.661131 GAGCCTCGCGCGATCCTA 61.661 66.667 34.86 10.97 44.76 2.94
871 872 3.011635 GCCTCTGCTTCTCCTCGCA 62.012 63.158 0.00 0.00 34.54 5.10
1170 1171 4.416738 GCTCCGCCTCCCTGCTTT 62.417 66.667 0.00 0.00 0.00 3.51
1194 1195 2.592861 GCCTGCATCCCCATCGTC 60.593 66.667 0.00 0.00 0.00 4.20
1248 1249 2.528127 TGCCCGAACCCTCAAGGA 60.528 61.111 0.00 0.00 39.89 3.36
1510 1513 3.754068 ACGGCTACACGTCTGACA 58.246 55.556 8.73 0.00 45.08 3.58
1528 1531 3.243805 TGACACCGTATTCGAACCTCAAA 60.244 43.478 0.00 0.00 39.71 2.69
1546 1549 3.118702 TCAAACGTCAAGTTCCACTACCA 60.119 43.478 0.00 0.00 43.37 3.25
1610 1613 3.871594 GCGATGCAACAAGTACCTCTATT 59.128 43.478 0.00 0.00 0.00 1.73
1656 1661 2.120053 TACCCCTACACCGCACCA 59.880 61.111 0.00 0.00 0.00 4.17
1661 1667 0.820074 CCCTACACCGCACCAAAACA 60.820 55.000 0.00 0.00 0.00 2.83
1662 1668 1.243902 CCTACACCGCACCAAAACAT 58.756 50.000 0.00 0.00 0.00 2.71
1715 1721 2.481449 GGAACCTTGTGCGACTATCGAT 60.481 50.000 2.16 2.16 43.74 3.59
1728 1734 2.159282 ACTATCGATGTGAACGACCACC 60.159 50.000 8.54 0.00 42.37 4.61
1747 1753 1.538512 CCGTCGACCTCAAGTTACTCA 59.461 52.381 10.58 0.00 0.00 3.41
1801 1807 0.599558 CTACCAACGAGGACCGACAA 59.400 55.000 5.70 0.00 41.22 3.18
1805 1811 1.067425 CCAACGAGGACCGACAATACA 60.067 52.381 0.00 0.00 41.22 2.29
1867 1875 3.745975 TCTACTTTGCACCGAACTTGATG 59.254 43.478 0.00 0.00 0.00 3.07
1874 1882 0.602638 ACCGAACTTGATGCGCTTCA 60.603 50.000 20.86 20.86 0.00 3.02
1968 1976 7.611467 TGAGATGGTTTCATGTAACTATTGCTT 59.389 33.333 13.82 3.20 30.52 3.91
1976 1984 1.003851 TAACTATTGCTTGCCGCGTC 58.996 50.000 4.92 0.00 43.27 5.19
1995 2003 4.615223 GCGTCTGATGTCTACTACACAACA 60.615 45.833 0.00 0.00 42.09 3.33
2066 2074 5.140454 ACAGTAGCAAATTTCCCTCAAGTT 58.860 37.500 0.00 0.00 0.00 2.66
2145 2153 2.671596 CAACCCTGCAACCAAATAACG 58.328 47.619 0.00 0.00 0.00 3.18
2162 2170 5.968528 ATAACGAAGAGTCTCTTGTGTCT 57.031 39.130 19.95 10.57 36.73 3.41
2452 2460 4.461431 TCACTCCAAAGTCACTAATAGCGA 59.539 41.667 0.00 0.00 31.71 4.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
245 246 4.425772 TGAACAAACCTCTCTCATCCCTA 58.574 43.478 0.00 0.00 0.00 3.53
723 724 4.537433 GGGCCAGCGAGCGAGAAT 62.537 66.667 4.39 0.00 0.00 2.40
745 746 2.282446 GGGATCGAGGGGGAGTGA 59.718 66.667 0.00 0.00 0.00 3.41
1223 1224 2.291043 GGGTTCGGGCAGGAGAAGA 61.291 63.158 0.00 0.00 0.00 2.87
1248 1249 3.349006 CGCACGGCAACAGCTCTT 61.349 61.111 0.00 0.00 35.29 2.85
1419 1421 3.773119 AGAGGTACTTGGCGAAAATCCTA 59.227 43.478 0.00 0.00 41.55 2.94
1510 1513 2.288395 ACGTTTGAGGTTCGAATACGGT 60.288 45.455 0.00 0.00 40.21 4.83
1546 1549 0.999406 CTTGTCGGATTCGCGACATT 59.001 50.000 22.29 0.00 43.34 2.71
1728 1734 2.483106 TCTGAGTAACTTGAGGTCGACG 59.517 50.000 9.92 0.00 0.00 5.12
1736 1742 6.085555 ACTTGACGAATCTGAGTAACTTGA 57.914 37.500 0.00 0.00 0.00 3.02
1747 1753 2.683867 CGTAGAGGGACTTGACGAATCT 59.316 50.000 0.00 0.00 45.51 2.40
1801 1807 5.182001 ACGTTCGTAGTGGAAGTAGTTGTAT 59.818 40.000 0.00 0.00 0.00 2.29
1805 1811 3.057946 GGACGTTCGTAGTGGAAGTAGTT 60.058 47.826 0.00 0.00 0.00 2.24
1874 1882 1.278637 CCTTCGAAGCGTGCGTTTT 59.721 52.632 19.99 0.00 0.00 2.43
1968 1976 1.138883 GTAGACATCAGACGCGGCA 59.861 57.895 17.71 0.00 0.00 5.69
1976 1984 8.031864 AGAAGAATGTTGTGTAGTAGACATCAG 58.968 37.037 14.39 0.00 41.14 2.90
1995 2003 4.755123 CCCAACAACGTCTACAAGAAGAAT 59.245 41.667 0.00 0.00 0.00 2.40
2066 2074 7.206789 TGGATTGATAAACCTTAGGTCATCA 57.793 36.000 18.83 18.83 33.12 3.07
2145 2153 4.202161 TGTTGGAGACACAAGAGACTCTTC 60.202 45.833 14.99 4.32 42.67 2.87
2162 2170 2.488167 CCATTGTACTGGGTGTGTTGGA 60.488 50.000 0.00 0.00 32.28 3.53
2175 2183 8.126700 GTGCACCTATACAATTTACCATTGTAC 58.873 37.037 5.22 0.00 44.28 2.90
2452 2460 7.928706 CCTACCATAATCTCTTCATTCGTTCTT 59.071 37.037 0.00 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.