Multiple sequence alignment - TraesCS2A01G171200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G171200 chr2A 100.000 2201 0 0 1 2201 126651915 126654115 0.000000e+00 4065.0
1 TraesCS2A01G171200 chr2A 87.732 1345 143 17 823 2157 779329378 779328046 0.000000e+00 1550.0
2 TraesCS2A01G171200 chr2A 81.952 543 88 7 248 788 779329914 779329380 3.330000e-123 451.0
3 TraesCS2A01G171200 chr7B 99.455 2201 12 0 1 2201 265361414 265363614 0.000000e+00 3999.0
4 TraesCS2A01G171200 chr6A 90.660 2227 173 21 1 2201 615378589 615376372 0.000000e+00 2928.0
5 TraesCS2A01G171200 chr3B 95.513 1248 54 2 1 1248 750895302 750894057 0.000000e+00 1993.0
6 TraesCS2A01G171200 chr3B 96.462 961 32 2 1243 2201 750878462 750877502 0.000000e+00 1585.0
7 TraesCS2A01G171200 chr4B 93.062 1254 77 8 952 2201 1795924 1797171 0.000000e+00 1825.0
8 TraesCS2A01G171200 chr7D 86.240 1548 164 40 674 2201 20431613 20433131 0.000000e+00 1633.0
9 TraesCS2A01G171200 chr7D 86.740 181 24 0 194 374 20431105 20431285 3.710000e-48 202.0
10 TraesCS2A01G171200 chr7D 82.778 180 31 0 408 587 20431289 20431468 6.290000e-36 161.0
11 TraesCS2A01G171200 chr6B 83.542 1756 215 44 461 2201 709010713 709009017 0.000000e+00 1574.0
12 TraesCS2A01G171200 chr6B 84.015 1564 183 43 652 2201 14021569 14020059 0.000000e+00 1441.0
13 TraesCS2A01G171200 chr6B 90.291 103 6 4 7 107 709011071 709010971 4.930000e-27 132.0
14 TraesCS2A01G171200 chr6B 94.643 56 2 1 53 107 14021641 14021586 3.890000e-13 86.1
15 TraesCS2A01G171200 chr3A 87.649 1344 142 18 823 2157 735228556 735227228 0.000000e+00 1541.0
16 TraesCS2A01G171200 chr3A 84.809 1231 149 22 1 1197 508522634 508523860 0.000000e+00 1203.0
17 TraesCS2A01G171200 chr3A 78.191 807 129 25 19 788 735229354 735228558 2.560000e-129 472.0
18 TraesCS2A01G171200 chr2D 83.976 674 89 16 806 1474 595527775 595527116 1.430000e-176 628.0
19 TraesCS2A01G171200 chr7A 78.981 314 64 2 268 580 321659707 321659395 1.710000e-51 213.0
20 TraesCS2A01G171200 chr5A 77.778 333 72 2 249 580 396475009 396475340 1.030000e-48 204.0
21 TraesCS2A01G171200 chr5D 80.745 161 27 2 441 600 38276178 38276335 2.970000e-24 122.0
22 TraesCS2A01G171200 chr3D 88.764 89 9 1 19 107 309696059 309696146 8.310000e-20 108.0
23 TraesCS2A01G171200 chr1A 78.846 156 29 2 441 595 551193205 551193053 3.870000e-18 102.0
24 TraesCS2A01G171200 chr4D 91.304 46 4 0 59 104 261364677 261364722 1.820000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G171200 chr2A 126651915 126654115 2200 False 4065.000000 4065 100.000000 1 2201 1 chr2A.!!$F1 2200
1 TraesCS2A01G171200 chr2A 779328046 779329914 1868 True 1000.500000 1550 84.842000 248 2157 2 chr2A.!!$R1 1909
2 TraesCS2A01G171200 chr7B 265361414 265363614 2200 False 3999.000000 3999 99.455000 1 2201 1 chr7B.!!$F1 2200
3 TraesCS2A01G171200 chr6A 615376372 615378589 2217 True 2928.000000 2928 90.660000 1 2201 1 chr6A.!!$R1 2200
4 TraesCS2A01G171200 chr3B 750894057 750895302 1245 True 1993.000000 1993 95.513000 1 1248 1 chr3B.!!$R2 1247
5 TraesCS2A01G171200 chr3B 750877502 750878462 960 True 1585.000000 1585 96.462000 1243 2201 1 chr3B.!!$R1 958
6 TraesCS2A01G171200 chr4B 1795924 1797171 1247 False 1825.000000 1825 93.062000 952 2201 1 chr4B.!!$F1 1249
7 TraesCS2A01G171200 chr7D 20431105 20433131 2026 False 665.333333 1633 85.252667 194 2201 3 chr7D.!!$F1 2007
8 TraesCS2A01G171200 chr6B 709009017 709011071 2054 True 853.000000 1574 86.916500 7 2201 2 chr6B.!!$R2 2194
9 TraesCS2A01G171200 chr6B 14020059 14021641 1582 True 763.550000 1441 89.329000 53 2201 2 chr6B.!!$R1 2148
10 TraesCS2A01G171200 chr3A 508522634 508523860 1226 False 1203.000000 1203 84.809000 1 1197 1 chr3A.!!$F1 1196
11 TraesCS2A01G171200 chr3A 735227228 735229354 2126 True 1006.500000 1541 82.920000 19 2157 2 chr3A.!!$R1 2138
12 TraesCS2A01G171200 chr2D 595527116 595527775 659 True 628.000000 628 83.976000 806 1474 1 chr2D.!!$R1 668

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
118 128 2.568956 TCAGGGTGAGTTCCAATCTCAG 59.431 50.0 0.0 0.0 41.66 3.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1323 1434 2.284625 AGGGCATCCACACCTCGA 60.285 61.111 0.0 0.0 34.83 4.04 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
118 128 2.568956 TCAGGGTGAGTTCCAATCTCAG 59.431 50.000 0.00 0.0 41.66 3.35
886 994 5.008331 TCACTGTTAGAATCGGTCTGTACT 58.992 41.667 0.00 0.0 37.12 2.73
1323 1434 3.671411 AGTCGAACAGCCGCTCGT 61.671 61.111 0.00 0.0 36.46 4.18
1989 2112 1.335324 GCACAATGCTCACAGGTGAAC 60.335 52.381 3.45 0.0 40.96 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 83 5.041191 TCTGCTTCCTCAAAGAAGAACTT 57.959 39.130 5.5 0.0 45.23 2.66
118 128 2.249844 TTCAACGAGGGAAAGTGGAC 57.750 50.000 0.0 0.0 0.00 4.02
1323 1434 2.284625 AGGGCATCCACACCTCGA 60.285 61.111 0.0 0.0 34.83 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.