Multiple sequence alignment - TraesCS2A01G148800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G148800 chr2A 100.000 2276 0 0 1 2276 95257351 95255076 0 4204
1 TraesCS2A01G148800 chr2A 97.541 976 22 2 1302 2276 733656235 733655261 0 1668
2 TraesCS2A01G148800 chr1B 93.175 1304 87 2 1 1303 26040665 26039363 0 1914
3 TraesCS2A01G148800 chr1B 98.035 865 17 0 412 1276 122979529 122978665 0 1504
4 TraesCS2A01G148800 chr1B 87.183 1303 164 3 1 1303 18863246 18861947 0 1478
5 TraesCS2A01G148800 chr1A 97.029 976 27 2 1302 2276 472139524 472138550 0 1640
6 TraesCS2A01G148800 chr1A 96.926 976 28 2 1302 2276 534171283 534172257 0 1635
7 TraesCS2A01G148800 chr1A 96.721 976 29 2 1302 2276 539462958 539463931 0 1622
8 TraesCS2A01G148800 chr5A 96.926 976 27 3 1302 2276 546134229 546133256 0 1633
9 TraesCS2A01G148800 chr5A 85.199 1304 186 7 1 1302 367708572 367709870 0 1332
10 TraesCS2A01G148800 chr3D 96.721 976 30 2 1302 2276 426433990 426433016 0 1624
11 TraesCS2A01G148800 chr6D 96.622 977 31 2 1302 2276 452522511 452521535 0 1620
12 TraesCS2A01G148800 chr6D 80.630 1301 236 15 1 1292 48448874 48450167 0 992
13 TraesCS2A01G148800 chr7A 96.619 976 31 2 1302 2276 510733405 510734379 0 1618
14 TraesCS2A01G148800 chr5D 96.619 976 30 3 1302 2276 424283452 424284425 0 1616
15 TraesCS2A01G148800 chr5D 89.760 1123 115 0 170 1292 532832825 532831703 0 1437
16 TraesCS2A01G148800 chr5B 87.280 1305 162 4 2 1304 665603716 665605018 0 1487
17 TraesCS2A01G148800 chr2D 90.189 1060 103 1 245 1303 39412539 39411480 0 1380
18 TraesCS2A01G148800 chr3B 96.782 808 26 0 496 1303 171818571 171819378 0 1349


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G148800 chr2A 95255076 95257351 2275 True 4204 4204 100.000 1 2276 1 chr2A.!!$R1 2275
1 TraesCS2A01G148800 chr2A 733655261 733656235 974 True 1668 1668 97.541 1302 2276 1 chr2A.!!$R2 974
2 TraesCS2A01G148800 chr1B 26039363 26040665 1302 True 1914 1914 93.175 1 1303 1 chr1B.!!$R2 1302
3 TraesCS2A01G148800 chr1B 122978665 122979529 864 True 1504 1504 98.035 412 1276 1 chr1B.!!$R3 864
4 TraesCS2A01G148800 chr1B 18861947 18863246 1299 True 1478 1478 87.183 1 1303 1 chr1B.!!$R1 1302
5 TraesCS2A01G148800 chr1A 472138550 472139524 974 True 1640 1640 97.029 1302 2276 1 chr1A.!!$R1 974
6 TraesCS2A01G148800 chr1A 534171283 534172257 974 False 1635 1635 96.926 1302 2276 1 chr1A.!!$F1 974
7 TraesCS2A01G148800 chr1A 539462958 539463931 973 False 1622 1622 96.721 1302 2276 1 chr1A.!!$F2 974
8 TraesCS2A01G148800 chr5A 546133256 546134229 973 True 1633 1633 96.926 1302 2276 1 chr5A.!!$R1 974
9 TraesCS2A01G148800 chr5A 367708572 367709870 1298 False 1332 1332 85.199 1 1302 1 chr5A.!!$F1 1301
10 TraesCS2A01G148800 chr3D 426433016 426433990 974 True 1624 1624 96.721 1302 2276 1 chr3D.!!$R1 974
11 TraesCS2A01G148800 chr6D 452521535 452522511 976 True 1620 1620 96.622 1302 2276 1 chr6D.!!$R1 974
12 TraesCS2A01G148800 chr6D 48448874 48450167 1293 False 992 992 80.630 1 1292 1 chr6D.!!$F1 1291
13 TraesCS2A01G148800 chr7A 510733405 510734379 974 False 1618 1618 96.619 1302 2276 1 chr7A.!!$F1 974
14 TraesCS2A01G148800 chr5D 424283452 424284425 973 False 1616 1616 96.619 1302 2276 1 chr5D.!!$F1 974
15 TraesCS2A01G148800 chr5D 532831703 532832825 1122 True 1437 1437 89.760 170 1292 1 chr5D.!!$R1 1122
16 TraesCS2A01G148800 chr5B 665603716 665605018 1302 False 1487 1487 87.280 2 1304 1 chr5B.!!$F1 1302
17 TraesCS2A01G148800 chr2D 39411480 39412539 1059 True 1380 1380 90.189 245 1303 1 chr2D.!!$R1 1058
18 TraesCS2A01G148800 chr3B 171818571 171819378 807 False 1349 1349 96.782 496 1303 1 chr3B.!!$F1 807

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
481 483 1.270518 ACGAGGATATGGAGCATGCAC 60.271 52.381 21.98 14.31 41.42 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1415 1424 0.829333 AGATTGATGGAGCTGCTCGT 59.171 50.0 22.25 13.98 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
86 87 4.694982 TGACTTGATTGATACACGCACATT 59.305 37.500 0.00 0.00 0.00 2.71
142 143 2.959357 GCACCAGACGCAACAGCTC 61.959 63.158 0.00 0.00 0.00 4.09
313 315 3.480470 ACTTCAGGTGATCAACAACAGG 58.520 45.455 14.46 1.57 38.92 4.00
361 363 3.072622 AGTTGTTCCTAAGGTCAGGGTTC 59.927 47.826 0.00 0.00 36.26 3.62
481 483 1.270518 ACGAGGATATGGAGCATGCAC 60.271 52.381 21.98 14.31 41.42 4.57
741 743 2.159028 GGACTTAGCCATTCTCGAGCTT 60.159 50.000 7.81 0.00 38.06 3.74
1092 1094 7.512992 CACCTATCCTGTTAGAAATTGGAGAT 58.487 38.462 0.00 0.00 0.00 2.75
1242 1245 5.398236 AGCTTCCTGATCAGTAGCCTATTA 58.602 41.667 29.24 0.00 35.85 0.98
1324 1331 4.235372 AGCCTTGTCTAGCCCTGTATAAT 58.765 43.478 0.00 0.00 0.00 1.28
1342 1349 7.161404 TGTATAATCCAGACCGTATACGTACT 58.839 38.462 22.87 17.51 37.74 2.73
1358 1366 1.895131 GTACTGTACCCTGGTCCGAAA 59.105 52.381 6.70 0.00 0.00 3.46
1415 1424 2.684374 CTGCCGAATCCAATCATTCACA 59.316 45.455 0.00 0.00 32.99 3.58
1474 1483 6.427242 CAGCTCCATAAGTCACGTAGTAGATA 59.573 42.308 0.00 0.00 41.61 1.98
1546 1555 2.131972 CAACGTCGTGAATCTCCAACA 58.868 47.619 0.00 0.00 0.00 3.33
1551 1560 2.993899 GTCGTGAATCTCCAACAATCGT 59.006 45.455 0.00 0.00 0.00 3.73
1732 1742 1.067142 GTGATCTGGGTTCACGTAGCA 60.067 52.381 0.00 0.00 34.67 3.49
1781 1791 5.584649 CACCAGTATCGTTATTTGATGTGGT 59.415 40.000 6.19 6.19 41.50 4.16
2090 2100 5.942826 GGAGTTTGGAGAACTGATGAAAGAT 59.057 40.000 0.00 0.00 0.00 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 3.118445 TCAAGTCACTGACCATGTGAACA 60.118 43.478 5.51 0.00 44.63 3.18
142 143 0.652592 CGCAGCGGGATGTTTAAGAG 59.347 55.000 7.00 0.00 0.00 2.85
299 301 2.571212 TCCACACCTGTTGTTGATCAC 58.429 47.619 0.00 0.00 35.67 3.06
313 315 3.123050 GTTTCCAAACTGCATTCCACAC 58.877 45.455 0.00 0.00 36.03 3.82
361 363 0.109086 CTCAGTACACGCCACCAGAG 60.109 60.000 0.00 0.00 0.00 3.35
481 483 1.268845 TGCATGCGAGCAATGCAATAG 60.269 47.619 22.74 0.00 46.73 1.73
741 743 0.323451 TAGAAGTGAGCTGCCGAGGA 60.323 55.000 0.00 0.00 0.00 3.71
1242 1245 1.016130 CATTCGCTGAACAGTCCGCT 61.016 55.000 3.77 0.00 32.20 5.52
1306 1313 5.304614 GTCTGGATTATACAGGGCTAGACAA 59.695 44.000 4.40 0.00 36.62 3.18
1324 1331 3.266510 ACAGTACGTATACGGTCTGGA 57.733 47.619 33.29 13.85 43.06 3.86
1415 1424 0.829333 AGATTGATGGAGCTGCTCGT 59.171 50.000 22.25 13.98 0.00 4.18
1474 1483 2.524394 AGATAGCCGCCGGTGGAT 60.524 61.111 38.08 34.10 0.00 3.41
1546 1555 1.740296 GCGGTACCTGTGCACGATT 60.740 57.895 13.13 0.39 0.00 3.34
1551 1560 2.267642 GGATGCGGTACCTGTGCA 59.732 61.111 14.29 14.29 43.67 4.57
1685 1695 2.002586 CAGCACTACCGGAACAAGATG 58.997 52.381 9.46 0.00 0.00 2.90
1781 1791 2.005370 CCGGATACCTAGGTTAGCCA 57.995 55.000 22.11 0.75 37.19 4.75
2090 2100 6.813293 TCATCTGACCAATCTTCTATCCAA 57.187 37.500 0.00 0.00 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.