Multiple sequence alignment - TraesCS2A01G148700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G148700 chr2A 100.000 2357 0 0 1 2357 95159728 95157372 0.000000e+00 4353.0
1 TraesCS2A01G148700 chr2A 97.964 2014 37 3 348 2357 95274093 95272080 0.000000e+00 3489.0
2 TraesCS2A01G148700 chr2A 77.621 782 159 14 598 1371 95260534 95259761 5.940000e-126 460.0
3 TraesCS2A01G148700 chr2A 74.392 617 128 21 599 1209 90029241 90029833 1.090000e-58 237.0
4 TraesCS2A01G148700 chr2A 84.337 249 14 10 126 358 95274496 95274257 1.100000e-53 220.0
5 TraesCS2A01G148700 chr2D 92.544 2119 105 16 227 2307 96681189 96679086 0.000000e+00 2988.0
6 TraesCS2A01G148700 chr2D 91.043 2166 130 22 204 2320 96751004 96748854 0.000000e+00 2867.0
7 TraesCS2A01G148700 chr2D 86.364 154 16 4 1 151 96751155 96751004 1.870000e-36 163.0
8 TraesCS2A01G148700 chr2B 88.747 2346 182 40 1 2314 147831746 147829451 0.000000e+00 2795.0
9 TraesCS2A01G148700 chr2B 88.747 2346 182 40 1 2314 147871499 147869204 0.000000e+00 2795.0
10 TraesCS2A01G148700 chr2B 91.280 1422 104 8 1 1414 148038502 148037093 0.000000e+00 1921.0
11 TraesCS2A01G148700 chr2B 93.362 919 49 6 1414 2320 148036995 148036077 0.000000e+00 1349.0
12 TraesCS2A01G148700 chr6B 76.980 1212 170 64 1153 2317 616430185 616431334 2.020000e-165 592.0
13 TraesCS2A01G148700 chr6B 77.266 651 95 29 1153 1758 616381530 616380888 1.350000e-87 333.0
14 TraesCS2A01G148700 chrUn 77.175 793 162 16 597 1380 17365887 17365105 5.980000e-121 444.0
15 TraesCS2A01G148700 chr6A 79.321 619 90 25 1155 1760 555323764 555323171 1.310000e-107 399.0
16 TraesCS2A01G148700 chr1A 75.935 428 88 13 937 1355 497579796 497580217 3.070000e-49 206.0
17 TraesCS2A01G148700 chr1A 75.650 423 88 13 937 1350 497584837 497585253 1.850000e-46 196.0
18 TraesCS2A01G148700 chr7D 75.000 448 96 12 919 1358 506883332 506882893 2.390000e-45 193.0
19 TraesCS2A01G148700 chr5D 97.368 38 1 0 1453 1490 124857735 124857772 5.440000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G148700 chr2A 95157372 95159728 2356 True 4353.0 4353 100.0000 1 2357 1 chr2A.!!$R1 2356
1 TraesCS2A01G148700 chr2A 95272080 95274496 2416 True 1854.5 3489 91.1505 126 2357 2 chr2A.!!$R3 2231
2 TraesCS2A01G148700 chr2A 95259761 95260534 773 True 460.0 460 77.6210 598 1371 1 chr2A.!!$R2 773
3 TraesCS2A01G148700 chr2A 90029241 90029833 592 False 237.0 237 74.3920 599 1209 1 chr2A.!!$F1 610
4 TraesCS2A01G148700 chr2D 96679086 96681189 2103 True 2988.0 2988 92.5440 227 2307 1 chr2D.!!$R1 2080
5 TraesCS2A01G148700 chr2D 96748854 96751155 2301 True 1515.0 2867 88.7035 1 2320 2 chr2D.!!$R2 2319
6 TraesCS2A01G148700 chr2B 147829451 147831746 2295 True 2795.0 2795 88.7470 1 2314 1 chr2B.!!$R1 2313
7 TraesCS2A01G148700 chr2B 147869204 147871499 2295 True 2795.0 2795 88.7470 1 2314 1 chr2B.!!$R2 2313
8 TraesCS2A01G148700 chr2B 148036077 148038502 2425 True 1635.0 1921 92.3210 1 2320 2 chr2B.!!$R3 2319
9 TraesCS2A01G148700 chr6B 616430185 616431334 1149 False 592.0 592 76.9800 1153 2317 1 chr6B.!!$F1 1164
10 TraesCS2A01G148700 chr6B 616380888 616381530 642 True 333.0 333 77.2660 1153 1758 1 chr6B.!!$R1 605
11 TraesCS2A01G148700 chrUn 17365105 17365887 782 True 444.0 444 77.1750 597 1380 1 chrUn.!!$R1 783
12 TraesCS2A01G148700 chr6A 555323171 555323764 593 True 399.0 399 79.3210 1155 1760 1 chr6A.!!$R1 605

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
166 173 0.109342 CTCCCGGATTGCTAATGGCT 59.891 55.0 0.73 0.0 42.39 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1682 2019 0.39113 TGTGGTAGCATTGCTCGGTC 60.391 55.0 15.81 5.74 40.44 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 4.468095 AATTCGGACTGTTCGTTCAAAG 57.532 40.909 8.55 0.00 0.00 2.77
65 66 2.875087 TCGGACTGTTCGTTCAAAGA 57.125 45.000 8.55 0.00 0.00 2.52
71 72 6.529125 TCGGACTGTTCGTTCAAAGAATATAC 59.471 38.462 8.55 0.00 0.00 1.47
137 144 2.749839 GCCCCGTACTTGCATGCA 60.750 61.111 18.46 18.46 0.00 3.96
165 172 1.518903 GCTCCCGGATTGCTAATGGC 61.519 60.000 0.73 0.00 42.22 4.40
166 173 0.109342 CTCCCGGATTGCTAATGGCT 59.891 55.000 0.73 0.00 42.39 4.75
187 194 2.754552 TCATGGGCGAAAGGAAAATCAG 59.245 45.455 0.00 0.00 0.00 2.90
250 269 2.883574 TGAAAGTGTTATAGACGCCGG 58.116 47.619 0.00 0.00 39.64 6.13
254 273 4.454728 AAGTGTTATAGACGCCGGTAAA 57.545 40.909 1.90 0.00 39.64 2.01
339 367 1.666189 GTAGATGGTCGAAAAGGCAGC 59.334 52.381 0.00 0.00 0.00 5.25
510 714 5.088739 CAGCAACGGAAATTAAGCTAACAG 58.911 41.667 0.00 0.00 0.00 3.16
570 777 3.681034 CGGCTTCAGGAGTCAAGATGAAT 60.681 47.826 0.00 0.00 31.69 2.57
593 800 2.158667 AGGGTTTTGTCTCATCAACCGT 60.159 45.455 0.00 0.00 39.80 4.83
594 801 2.225727 GGGTTTTGTCTCATCAACCGTC 59.774 50.000 0.00 0.00 39.80 4.79
699 906 0.673644 CCGTGAACTTTCGCTCCCAT 60.674 55.000 1.32 0.00 35.61 4.00
913 1120 0.536233 CAACACGGGTTCCATGGACA 60.536 55.000 15.91 2.99 34.21 4.02
1110 1317 2.970324 GCGAAAGACACACGCCCA 60.970 61.111 0.00 0.00 45.35 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 140 1.656818 CGGGAGCGAATTTGGTGCAT 61.657 55.000 16.95 0.00 0.00 3.96
137 144 0.034477 AATCCGGGAGCGAATTTGGT 60.034 50.000 0.00 0.00 0.00 3.67
165 172 2.754552 TGATTTTCCTTTCGCCCATGAG 59.245 45.455 0.00 0.00 0.00 2.90
166 173 2.754552 CTGATTTTCCTTTCGCCCATGA 59.245 45.455 0.00 0.00 0.00 3.07
187 194 1.134007 TCATGCATGGATGGTGACTCC 60.134 52.381 25.97 0.00 0.00 3.85
250 269 3.666797 GCCTTGTGCATACGTTGTTTTAC 59.333 43.478 0.00 0.00 40.77 2.01
339 367 4.022762 TCGAACCCATAACAAACATGTTGG 60.023 41.667 12.82 12.18 33.59 3.77
510 714 2.759038 GCTCGTGCTTTTGTTCGTATC 58.241 47.619 1.41 0.00 36.03 2.24
570 777 4.069304 CGGTTGATGAGACAAAACCCTAA 58.931 43.478 0.00 0.00 39.12 2.69
593 800 1.210931 CGGTTCGTCAACTAGCGGA 59.789 57.895 0.00 0.00 32.50 5.54
594 801 1.804326 CCGGTTCGTCAACTAGCGG 60.804 63.158 0.00 0.00 31.30 5.52
699 906 2.116556 GCCAAGAACCCCGGGAAA 59.883 61.111 26.32 0.00 0.00 3.13
996 1203 1.211969 CGACCTCGACGACATGGTT 59.788 57.895 8.49 0.00 43.02 3.67
1682 2019 0.391130 TGTGGTAGCATTGCTCGGTC 60.391 55.000 15.81 5.74 40.44 4.79
1760 2104 2.312140 AGATATAAGCCGGCCTCTAGGA 59.688 50.000 26.15 2.11 37.39 2.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.