Multiple sequence alignment - TraesCS2A01G144000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G144000 chr2A 100.000 2246 0 0 1 2246 88834934 88837179 0.000000e+00 4148
1 TraesCS2A01G144000 chr2A 96.653 2241 70 3 2 2242 708688407 708690642 0.000000e+00 3718
2 TraesCS2A01G144000 chr2A 96.659 838 27 1 2 838 3340882 3341719 0.000000e+00 1391
3 TraesCS2A01G144000 chr3A 96.615 2245 71 4 2 2246 743242940 743240701 0.000000e+00 3720
4 TraesCS2A01G144000 chr3A 96.169 2010 51 5 2 2009 41657056 41659041 0.000000e+00 3262
5 TraesCS2A01G144000 chr7A 96.438 2246 68 2 2 2246 106589958 106587724 0.000000e+00 3694
6 TraesCS2A01G144000 chr7A 97.273 1320 34 1 2 1321 647417599 647416282 0.000000e+00 2237
7 TraesCS2A01G144000 chr6A 96.123 2012 56 6 2 2012 616335725 616333735 0.000000e+00 3264
8 TraesCS2A01G144000 chr4A 95.865 1596 60 3 2 1597 630614312 630612723 0.000000e+00 2577
9 TraesCS2A01G144000 chr4A 96.866 1340 41 1 259 1597 587723613 587724952 0.000000e+00 2241
10 TraesCS2A01G144000 chr4A 97.269 659 18 0 1588 2246 587727006 587727664 0.000000e+00 1118
11 TraesCS2A01G144000 chr4A 96.347 657 24 0 1588 2244 630611974 630611318 0.000000e+00 1081
12 TraesCS2A01G144000 chr1A 95.303 1320 42 4 2 1321 287039096 287040395 0.000000e+00 2076
13 TraesCS2A01G144000 chr5D 97.662 385 9 0 1862 2246 391944512 391944896 0.000000e+00 662
14 TraesCS2A01G144000 chr5B 97.143 385 11 0 1862 2246 57787986 57788370 0.000000e+00 651
15 TraesCS2A01G144000 chr2D 96.883 385 11 1 1862 2246 90784034 90784417 0.000000e+00 643
16 TraesCS2A01G144000 chr5A 96.623 385 13 0 1862 2246 684289049 684289433 6.760000e-180 640


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G144000 chr2A 88834934 88837179 2245 False 4148.0 4148 100.0000 1 2246 1 chr2A.!!$F2 2245
1 TraesCS2A01G144000 chr2A 708688407 708690642 2235 False 3718.0 3718 96.6530 2 2242 1 chr2A.!!$F3 2240
2 TraesCS2A01G144000 chr2A 3340882 3341719 837 False 1391.0 1391 96.6590 2 838 1 chr2A.!!$F1 836
3 TraesCS2A01G144000 chr3A 743240701 743242940 2239 True 3720.0 3720 96.6150 2 2246 1 chr3A.!!$R1 2244
4 TraesCS2A01G144000 chr3A 41657056 41659041 1985 False 3262.0 3262 96.1690 2 2009 1 chr3A.!!$F1 2007
5 TraesCS2A01G144000 chr7A 106587724 106589958 2234 True 3694.0 3694 96.4380 2 2246 1 chr7A.!!$R1 2244
6 TraesCS2A01G144000 chr7A 647416282 647417599 1317 True 2237.0 2237 97.2730 2 1321 1 chr7A.!!$R2 1319
7 TraesCS2A01G144000 chr6A 616333735 616335725 1990 True 3264.0 3264 96.1230 2 2012 1 chr6A.!!$R1 2010
8 TraesCS2A01G144000 chr4A 630611318 630614312 2994 True 1829.0 2577 96.1060 2 2244 2 chr4A.!!$R1 2242
9 TraesCS2A01G144000 chr4A 587723613 587727664 4051 False 1679.5 2241 97.0675 259 2246 2 chr4A.!!$F1 1987
10 TraesCS2A01G144000 chr1A 287039096 287040395 1299 False 2076.0 2076 95.3030 2 1321 1 chr1A.!!$F1 1319

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
401 417 5.063312 GCTAGAACTCAATGCTTCTTCACTC 59.937 44.0 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1384 1402 0.037734 GGTTCGATCCCCCTTGTTGT 59.962 55.0 0.63 0.0 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 197 9.835389 TCATGTTCTTCAAATTTTGATTTTCCT 57.165 25.926 12.39 0.00 39.84 3.36
401 417 5.063312 GCTAGAACTCAATGCTTCTTCACTC 59.937 44.000 0.00 0.00 0.00 3.51
976 993 5.697067 ACCGATCATTAACTAGAGACCTCT 58.303 41.667 0.00 4.81 43.40 3.69
1045 1063 2.964768 GTGCAAAGAAAAAGCGACTACG 59.035 45.455 0.00 0.00 42.93 3.51
1175 1193 0.034337 CAAGGCAAGGCAGCAAACAT 59.966 50.000 0.00 0.00 35.83 2.71
1372 1390 6.653526 TTCAACATCAATTCAACATGAGGT 57.346 33.333 0.00 0.00 41.82 3.85
1382 1400 1.486726 CAACATGAGGTAGGGAGGGAC 59.513 57.143 0.00 0.00 0.00 4.46
1384 1402 2.224077 ACATGAGGTAGGGAGGGACTA 58.776 52.381 0.00 0.00 41.55 2.59
1491 1509 3.770040 CGATCTGGCCACCGTCCA 61.770 66.667 0.00 0.00 0.00 4.02
1605 3817 3.994392 TGCAAGTAGTACTGCTTTGCTAC 59.006 43.478 29.11 17.45 33.23 3.58
1654 3866 6.610075 ATTTCTACCATGCTTCCATTTTGT 57.390 33.333 0.00 0.00 0.00 2.83
1798 4011 9.725019 AGACAGATCACACAAATTCAGTATTAA 57.275 29.630 0.00 0.00 0.00 1.40
1957 4172 1.211190 GTCTCTTAACCGACGCCGT 59.789 57.895 0.00 0.00 0.00 5.68
2025 4240 7.313646 GTGCATACTGACTAACTGAAGAACTA 58.686 38.462 0.00 0.00 0.00 2.24
2199 4414 0.975556 TAGAGCGATCCTTGGTGCCA 60.976 55.000 0.00 0.00 0.00 4.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.952310 GGTCAGGCCAATGTAGAAATCC 59.048 50.000 5.01 0.00 37.17 3.01
401 417 2.725203 TTTCGTCGTGGGCTCCAAGG 62.725 60.000 7.17 0.00 34.18 3.61
697 713 6.127703 TGTTCAAACGGTTAAATTCTGGTTCA 60.128 34.615 0.00 0.00 0.00 3.18
932 949 5.391950 CGGTATTGAGAGATTTTGGTGGTTG 60.392 44.000 0.00 0.00 0.00 3.77
982 999 0.704076 ATGGCTGTTAGGGCTTTGGA 59.296 50.000 0.00 0.00 0.00 3.53
1045 1063 2.772691 CGTCTACGGCCCCTGAGAC 61.773 68.421 0.00 4.01 35.91 3.36
1175 1193 3.867600 GCTTGACTGCCTCTGATTCTTCA 60.868 47.826 0.00 0.00 0.00 3.02
1372 1390 2.561297 CCCTTGTTGTAGTCCCTCCCTA 60.561 54.545 0.00 0.00 0.00 3.53
1382 1400 2.629051 GTTCGATCCCCCTTGTTGTAG 58.371 52.381 0.00 0.00 0.00 2.74
1384 1402 0.037734 GGTTCGATCCCCCTTGTTGT 59.962 55.000 0.63 0.00 0.00 3.32
1491 1509 2.040464 ATGGGCCTCGACCTCCAT 60.040 61.111 4.53 3.58 35.38 3.41
1605 3817 3.389925 AAATTGTGTGATTGCACCTGG 57.610 42.857 0.00 0.00 44.51 4.45
1654 3866 7.092079 CACAATCAATTGATTTCTGGTTGCTA 58.908 34.615 27.30 0.00 42.41 3.49
1957 4172 2.901192 TGTTCTTGTCCCCTGTATTCGA 59.099 45.455 0.00 0.00 0.00 3.71
2025 4240 0.468226 TTGGCCACTGAAACTCGAGT 59.532 50.000 13.58 13.58 0.00 4.18
2199 4414 4.778143 GCACCTCCGACGGGCAAT 62.778 66.667 15.25 0.00 0.00 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.