Multiple sequence alignment - TraesCS2A01G116400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G116400 chr2A 100.000 2702 0 0 1 2702 66482035 66479334 0.000000e+00 4990.0
1 TraesCS2A01G116400 chr2A 96.606 2622 49 12 85 2702 66460334 66457749 0.000000e+00 4313.0
2 TraesCS2A01G116400 chr2A 97.796 2042 33 6 662 2702 66332130 66330100 0.000000e+00 3511.0
3 TraesCS2A01G116400 chr2A 97.699 2043 35 9 662 2702 66375667 66373635 0.000000e+00 3502.0
4 TraesCS2A01G116400 chr2A 95.271 1586 33 13 1118 2702 66522986 66521442 0.000000e+00 2475.0
5 TraesCS2A01G116400 chr2A 98.924 1115 12 0 3 1117 66524336 66523222 0.000000e+00 1993.0
6 TraesCS2A01G116400 chr2A 99.012 607 5 1 1 606 66332733 66332127 0.000000e+00 1086.0
7 TraesCS2A01G116400 chr2A 99.544 439 1 1 1 438 66376237 66375799 0.000000e+00 798.0
8 TraesCS2A01G116400 chr2A 97.857 140 3 0 467 606 66375803 66375664 2.690000e-60 243.0
9 TraesCS2A01G116400 chr2A 92.045 88 7 0 1 88 66461051 66460964 1.020000e-24 124.0
10 TraesCS2A01G116400 chr2D 89.802 2177 138 36 324 2455 68672020 68674157 0.000000e+00 2713.0
11 TraesCS2A01G116400 chr2D 91.657 1810 113 20 663 2455 68627157 68628945 0.000000e+00 2471.0
12 TraesCS2A01G116400 chr2D 87.518 2051 106 60 144 2100 68657765 68659759 0.000000e+00 2231.0
13 TraesCS2A01G116400 chr2D 89.233 1681 81 45 144 1750 68692305 68693959 0.000000e+00 2010.0
14 TraesCS2A01G116400 chr2D 88.846 1551 94 38 663 2177 68589664 68591171 0.000000e+00 1832.0
15 TraesCS2A01G116400 chr2D 88.781 1551 95 35 663 2177 68566074 68567581 0.000000e+00 1827.0
16 TraesCS2A01G116400 chr2D 91.304 368 28 4 2337 2702 68696492 68696857 1.440000e-137 499.0
17 TraesCS2A01G116400 chr2D 91.690 361 26 4 2344 2702 68571650 68572008 5.200000e-137 497.0
18 TraesCS2A01G116400 chr2D 91.304 368 27 5 2337 2702 68595250 68595614 5.200000e-137 497.0
19 TraesCS2A01G116400 chr2D 90.761 368 27 5 2337 2702 68663835 68664197 4.040000e-133 484.0
20 TraesCS2A01G116400 chr2D 92.366 262 19 1 2442 2702 68629483 68629744 3.290000e-99 372.0
21 TraesCS2A01G116400 chr2D 96.939 98 3 0 2217 2314 68567582 68567679 5.980000e-37 165.0
22 TraesCS2A01G116400 chr2D 96.939 98 3 0 2217 2314 68591172 68591269 5.980000e-37 165.0
23 TraesCS2A01G116400 chr2D 100.000 28 0 0 283 310 68658267 68658294 5.000000e-03 52.8
24 TraesCS2A01G116400 chr2D 100.000 28 0 0 283 310 68692807 68692834 5.000000e-03 52.8
25 TraesCS2A01G116400 chr2B 83.200 250 30 8 338 578 105411130 105411376 4.530000e-53 219.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G116400 chr2A 66479334 66482035 2701 True 4990.000000 4990 100.000000 1 2702 1 chr2A.!!$R1 2701
1 TraesCS2A01G116400 chr2A 66330100 66332733 2633 True 2298.500000 3511 98.404000 1 2702 2 chr2A.!!$R2 2701
2 TraesCS2A01G116400 chr2A 66521442 66524336 2894 True 2234.000000 2475 97.097500 3 2702 2 chr2A.!!$R5 2699
3 TraesCS2A01G116400 chr2A 66457749 66461051 3302 True 2218.500000 4313 94.325500 1 2702 2 chr2A.!!$R4 2701
4 TraesCS2A01G116400 chr2A 66373635 66376237 2602 True 1514.333333 3502 98.366667 1 2702 3 chr2A.!!$R3 2701
5 TraesCS2A01G116400 chr2D 68672020 68674157 2137 False 2713.000000 2713 89.802000 324 2455 1 chr2D.!!$F2 2131
6 TraesCS2A01G116400 chr2D 68627157 68629744 2587 False 1421.500000 2471 92.011500 663 2702 2 chr2D.!!$F5 2039
7 TraesCS2A01G116400 chr2D 68657765 68659759 1994 False 1141.900000 2231 93.759000 144 2100 2 chr2D.!!$F6 1956
8 TraesCS2A01G116400 chr2D 68692305 68696857 4552 False 853.933333 2010 93.512333 144 2702 3 chr2D.!!$F7 2558
9 TraesCS2A01G116400 chr2D 68589664 68595614 5950 False 831.333333 1832 92.363000 663 2702 3 chr2D.!!$F4 2039
10 TraesCS2A01G116400 chr2D 68566074 68572008 5934 False 829.666667 1827 92.470000 663 2702 3 chr2D.!!$F3 2039

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
33 34 1.066587 CCCTTCTCGATCGTGCCTC 59.933 63.158 15.94 0.0 0.00 4.70 F
1286 2225 2.669569 GCTCACCTTTCTGGCGCA 60.670 61.111 10.83 0.0 40.22 6.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1286 2225 0.538977 AACCTTCATGCTGCTGCTGT 60.539 50.000 17.0 2.77 40.48 4.40 R
2556 9805 5.001232 TCTACATGTCCCTGTTTTGTTAGC 58.999 41.667 0.0 0.00 0.00 3.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 1.066587 CCCTTCTCGATCGTGCCTC 59.933 63.158 15.94 0.0 0.00 4.70
1285 2224 3.793144 CGCTCACCTTTCTGGCGC 61.793 66.667 0.00 0.0 39.42 6.53
1286 2225 2.669569 GCTCACCTTTCTGGCGCA 60.670 61.111 10.83 0.0 40.22 6.09
1716 2661 0.532417 GCTAGGCTAGAGTCGTCGGA 60.532 60.000 25.37 0.0 0.00 4.55
1717 2662 1.950828 CTAGGCTAGAGTCGTCGGAA 58.049 55.000 16.70 0.0 0.00 4.30
1859 2816 2.161410 TGCTGTTGCCATTAATCGTGTC 59.839 45.455 0.00 0.0 38.71 3.67
1913 2870 2.146342 GCCGGATTGATTCGATCATGT 58.854 47.619 5.05 0.0 39.39 3.21
1950 2928 3.390135 CGTACGAAGGGCATCACAATAT 58.610 45.455 10.44 0.0 0.00 1.28
1980 2958 3.939592 AGAGAAGCGGCCAACTAATTAAC 59.060 43.478 2.24 0.0 0.00 2.01
1985 2963 2.078392 CGGCCAACTAATTAACACGGT 58.922 47.619 2.24 0.0 0.00 4.83
2347 9043 3.691118 GGCATAGCTTTGACAGTGAATGA 59.309 43.478 8.49 0.0 0.00 2.57
2390 9087 0.741221 GCTCAAGCCTCCGAACGAAT 60.741 55.000 0.00 0.0 34.31 3.34
2464 9712 7.387397 GCCAGAAATAGATATCTCAAGGACAAG 59.613 40.741 8.95 0.0 0.00 3.16
2556 9805 5.352643 TCTCGCATCAAATCAATAGCATG 57.647 39.130 0.00 0.0 0.00 4.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1285 2224 1.241990 ACCTTCATGCTGCTGCTGTG 61.242 55.000 17.00 14.59 40.48 3.66
1286 2225 0.538977 AACCTTCATGCTGCTGCTGT 60.539 50.000 17.00 2.77 40.48 4.40
1716 2661 3.305335 GCCGTGATTCACTCCAACATTTT 60.305 43.478 14.54 0.00 31.34 1.82
1717 2662 2.228822 GCCGTGATTCACTCCAACATTT 59.771 45.455 14.54 0.00 31.34 2.32
1980 2958 3.560068 GGCTAACAATTATCTCCACCGTG 59.440 47.826 0.00 0.00 0.00 4.94
1985 2963 6.957631 TCTTTCAGGCTAACAATTATCTCCA 58.042 36.000 0.00 0.00 0.00 3.86
2390 9087 7.724951 TCATATTATCTGGTGCATTTCCATCAA 59.275 33.333 0.00 0.00 34.26 2.57
2556 9805 5.001232 TCTACATGTCCCTGTTTTGTTAGC 58.999 41.667 0.00 0.00 0.00 3.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.