Multiple sequence alignment - TraesCS2A01G116300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G116300 chr2A 100.000 2702 0 0 1 2702 66376329 66373628 0.000000e+00 4990.0
1 TraesCS2A01G116300 chr2A 98.030 2183 27 9 527 2702 66332266 66330093 0.000000e+00 3779.0
2 TraesCS2A01G116300 chr2A 97.707 2050 35 9 663 2702 66481374 66479327 0.000000e+00 3515.0
3 TraesCS2A01G116300 chr2A 97.604 2045 22 8 663 2702 66459764 66457742 0.000000e+00 3480.0
4 TraesCS2A01G116300 chr2A 96.784 1586 16 9 1118 2702 66522986 66521435 0.000000e+00 2614.0
5 TraesCS2A01G116300 chr2A 99.623 531 2 0 1 531 66332825 66332295 0.000000e+00 970.0
6 TraesCS2A01G116300 chr2A 99.385 488 2 1 44 531 66482084 66481598 0.000000e+00 883.0
7 TraesCS2A01G116300 chr2A 97.279 441 11 1 91 531 66524340 66523901 0.000000e+00 747.0
8 TraesCS2A01G116300 chr2A 94.085 355 13 4 177 531 66460334 66459988 1.420000e-147 532.0
9 TraesCS2A01G116300 chr2A 93.370 181 11 1 1 180 66461144 66460964 1.590000e-67 267.0
10 TraesCS2A01G116300 chr2A 97.857 140 3 0 527 666 66459959 66459820 2.690000e-60 243.0
11 TraesCS2A01G116300 chr2A 97.857 140 3 0 527 666 66481569 66481430 2.690000e-60 243.0
12 TraesCS2A01G116300 chr2A 97.857 140 3 0 527 666 66523872 66523733 2.690000e-60 243.0
13 TraesCS2A01G116300 chr2D 92.180 1803 112 18 667 2449 68672364 68674157 0.000000e+00 2521.0
14 TraesCS2A01G116300 chr2D 92.082 1806 106 23 664 2449 68627157 68628945 0.000000e+00 2508.0
15 TraesCS2A01G116300 chr2D 89.657 1547 83 30 664 2172 68589664 68591171 0.000000e+00 1899.0
16 TraesCS2A01G116300 chr2D 89.593 1547 84 29 664 2172 68566074 68567581 0.000000e+00 1893.0
17 TraesCS2A01G116300 chr2D 88.752 1458 78 32 687 2098 68658342 68659759 0.000000e+00 1705.0
18 TraesCS2A01G116300 chr2D 91.820 1088 53 17 687 1748 68692882 68693959 0.000000e+00 1483.0
19 TraesCS2A01G116300 chr2D 91.304 368 28 4 2337 2702 68571650 68572015 1.440000e-137 499.0
20 TraesCS2A01G116300 chr2D 90.933 375 29 5 2330 2702 68595250 68595621 1.440000e-137 499.0
21 TraesCS2A01G116300 chr2D 90.400 375 32 4 2330 2702 68696492 68696864 8.690000e-135 490.0
22 TraesCS2A01G116300 chr2D 90.133 375 30 5 2330 2702 68663835 68664204 5.230000e-132 481.0
23 TraesCS2A01G116300 chr2D 91.078 269 22 2 2436 2702 68629483 68629751 1.980000e-96 363.0
24 TraesCS2A01G116300 chr2D 88.629 299 20 8 237 526 68692305 68692598 4.280000e-93 351.0
25 TraesCS2A01G116300 chr2D 89.437 284 19 4 237 513 68657765 68658044 5.540000e-92 348.0
26 TraesCS2A01G116300 chr2D 90.780 141 8 3 527 663 68658104 68658243 1.650000e-42 183.0
27 TraesCS2A01G116300 chr2D 89.362 141 10 3 527 663 68692644 68692783 3.580000e-39 172.0
28 TraesCS2A01G116300 chr2D 88.028 142 10 4 20 161 68562193 68562327 7.740000e-36 161.0
29 TraesCS2A01G116300 chr2D 87.162 148 12 4 17 164 68584348 68584488 7.740000e-36 161.0
30 TraesCS2A01G116300 chr2D 94.000 100 5 1 2209 2307 68567580 68567679 1.680000e-32 150.0
31 TraesCS2A01G116300 chr2D 94.000 100 5 1 2209 2307 68591170 68591269 1.680000e-32 150.0
32 TraesCS2A01G116300 chr2D 77.739 283 25 21 417 663 68672020 68672300 3.630000e-29 139.0
33 TraesCS2A01G116300 chr2D 100.000 28 0 0 376 403 68658267 68658294 5.000000e-03 52.8
34 TraesCS2A01G116300 chr2D 100.000 28 0 0 376 403 68692807 68692834 5.000000e-03 52.8
35 TraesCS2A01G116300 chr2B 88.889 108 7 3 536 638 105411269 105411376 7.850000e-26 128.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G116300 chr2A 66373628 66376329 2701 True 4990.000000 4990 100.000000 1 2702 1 chr2A.!!$R1 2701
1 TraesCS2A01G116300 chr2A 66330093 66332825 2732 True 2374.500000 3779 98.826500 1 2702 2 chr2A.!!$R2 2701
2 TraesCS2A01G116300 chr2A 66479327 66482084 2757 True 1547.000000 3515 98.316333 44 2702 3 chr2A.!!$R4 2658
3 TraesCS2A01G116300 chr2A 66521435 66524340 2905 True 1201.333333 2614 97.306667 91 2702 3 chr2A.!!$R5 2611
4 TraesCS2A01G116300 chr2A 66457742 66461144 3402 True 1130.500000 3480 95.729000 1 2702 4 chr2A.!!$R3 2701
5 TraesCS2A01G116300 chr2D 68627157 68629751 2594 False 1435.500000 2508 91.580000 664 2702 2 chr2D.!!$F5 2038
6 TraesCS2A01G116300 chr2D 68672020 68674157 2137 False 1330.000000 2521 84.959500 417 2449 2 chr2D.!!$F7 2032
7 TraesCS2A01G116300 chr2D 68589664 68595621 5957 False 849.333333 1899 91.530000 664 2702 3 chr2D.!!$F4 2038
8 TraesCS2A01G116300 chr2D 68562193 68572015 9822 False 675.750000 1893 90.731250 20 2702 4 chr2D.!!$F3 2682
9 TraesCS2A01G116300 chr2D 68657765 68659759 1994 False 572.200000 1705 92.242250 237 2098 4 chr2D.!!$F6 1861
10 TraesCS2A01G116300 chr2D 68692305 68696864 4559 False 509.760000 1483 92.042200 237 2702 5 chr2D.!!$F8 2465

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1778 5930 7.948357 AGATTTGATTAGTACATGCATGCATT 58.052 30.769 30.32 21.91 33.9 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2662 13157 3.055891 CCTTTGCCCCTTTCAACTATTGG 60.056 47.826 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1778 5930 7.948357 AGATTTGATTAGTACATGCATGCATT 58.052 30.769 30.32 21.91 33.90 3.56
1863 6018 3.586892 TGCCATTAATCGTGTTCGTGTA 58.413 40.909 0.00 0.00 38.33 2.90
2164 8023 0.238289 CATGGACACAAACTGCGACC 59.762 55.000 0.00 0.00 0.00 4.79
2532 13026 1.671328 CGTCGACCATCTTAGCTCTCA 59.329 52.381 10.58 0.00 0.00 3.27
2612 13106 0.036388 TCTTCATGACGTGCCTTCCC 60.036 55.000 0.00 0.00 0.00 3.97
2662 13157 0.878416 TTTCCGCATACAGTGTTGCC 59.122 50.000 18.52 7.07 35.41 4.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 49 1.227823 CACCATCACACACACCGGT 60.228 57.895 0.00 0.00 0.00 5.28
1778 5930 3.519107 TCTCATGATTACAACAGGGAGCA 59.481 43.478 0.00 0.00 0.00 4.26
2164 8023 5.551760 ACTGAAAGACAATATGCCTTTCG 57.448 39.130 12.39 10.16 45.76 3.46
2232 8096 4.281435 TGGGCAATATTAATGTCATGCTGG 59.719 41.667 8.27 0.00 34.37 4.85
2532 13026 8.523915 TTGTTAGGATGCTATTGATTTGATGT 57.476 30.769 0.00 0.00 0.00 3.06
2612 13106 6.712276 ACCTTTTCAGTTCTTATACTCAGGG 58.288 40.000 0.00 0.00 0.00 4.45
2662 13157 3.055891 CCTTTGCCCCTTTCAACTATTGG 60.056 47.826 0.00 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.