Multiple sequence alignment - TraesCS2A01G090800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G090800 chr2A 100.000 2504 0 0 1 2504 43392669 43390166 0 4625
1 TraesCS2A01G090800 chr2A 99.123 2509 13 7 1 2504 719466167 719463663 0 4503
2 TraesCS2A01G090800 chr5B 99.044 2510 13 9 1 2504 179239833 179237329 0 4492
3 TraesCS2A01G090800 chr5B 98.764 2509 21 8 1 2504 406858242 406860745 0 4453
4 TraesCS2A01G090800 chr6B 98.964 2509 16 7 1 2504 408674338 408671835 0 4481
5 TraesCS2A01G090800 chr6B 98.764 2509 22 7 1 2504 704838301 704840805 0 4453
6 TraesCS2A01G090800 chr7B 98.845 2510 20 7 1 2504 528912473 528909967 0 4466
7 TraesCS2A01G090800 chr7B 98.566 2510 24 10 1 2504 68109802 68107299 0 4425
8 TraesCS2A01G090800 chr7A 98.725 2509 24 6 1 2504 171431012 171428507 0 4449
9 TraesCS2A01G090800 chr3B 98.604 2507 24 8 1 2501 552490509 552488008 0 4425


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G090800 chr2A 43390166 43392669 2503 True 4625 4625 100.000 1 2504 1 chr2A.!!$R1 2503
1 TraesCS2A01G090800 chr2A 719463663 719466167 2504 True 4503 4503 99.123 1 2504 1 chr2A.!!$R2 2503
2 TraesCS2A01G090800 chr5B 179237329 179239833 2504 True 4492 4492 99.044 1 2504 1 chr5B.!!$R1 2503
3 TraesCS2A01G090800 chr5B 406858242 406860745 2503 False 4453 4453 98.764 1 2504 1 chr5B.!!$F1 2503
4 TraesCS2A01G090800 chr6B 408671835 408674338 2503 True 4481 4481 98.964 1 2504 1 chr6B.!!$R1 2503
5 TraesCS2A01G090800 chr6B 704838301 704840805 2504 False 4453 4453 98.764 1 2504 1 chr6B.!!$F1 2503
6 TraesCS2A01G090800 chr7B 528909967 528912473 2506 True 4466 4466 98.845 1 2504 1 chr7B.!!$R2 2503
7 TraesCS2A01G090800 chr7B 68107299 68109802 2503 True 4425 4425 98.566 1 2504 1 chr7B.!!$R1 2503
8 TraesCS2A01G090800 chr7A 171428507 171431012 2505 True 4449 4449 98.725 1 2504 1 chr7A.!!$R1 2503
9 TraesCS2A01G090800 chr3B 552488008 552490509 2501 True 4425 4425 98.604 1 2501 1 chr3B.!!$R1 2500

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1436 1445 8.742777 TGATCAACTAAAGCTAGCATTCAAATT 58.257 29.63 18.83 0.0 0.0 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2343 2356 5.163519 GCCTATCATGTTGCCAAGTTTACAT 60.164 40.0 0.0 0.0 0.0 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1436 1445 8.742777 TGATCAACTAAAGCTAGCATTCAAATT 58.257 29.630 18.83 0.00 0.00 1.82
1600 1609 4.381612 CCGGAACTCAGTTGCTGTATCTAA 60.382 45.833 7.53 0.00 31.77 2.10
1824 1833 5.599048 ATCTAGCTTCTCATAGAGGAGGT 57.401 43.478 11.38 11.38 46.30 3.85
2343 2356 6.767902 TGGGTTAAAGCATGCATTTGTTTTTA 59.232 30.769 21.98 10.90 33.05 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1600 1609 5.139727 TGGTTCATCAACATCCAAAGAGTT 58.860 37.50 0.0 0.0 33.7 3.01
1896 1907 9.665719 TTGACAAAATCTTATACATCAGCTACA 57.334 29.63 0.0 0.0 0.0 2.74
2343 2356 5.163519 GCCTATCATGTTGCCAAGTTTACAT 60.164 40.00 0.0 0.0 0.0 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.