Multiple sequence alignment - TraesCS2A01G090700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G090700 chr2A 100.000 2924 0 0 1 2924 43380271 43383194 0 5400
1 TraesCS2A01G090700 chr2A 99.009 2926 24 5 1 2924 719453777 719456699 0 5238
2 TraesCS2A01G090700 chr5B 99.043 2926 23 5 1 2924 179227002 179229924 0 5243
3 TraesCS2A01G090700 chr5B 98.941 2928 25 6 1 2924 406870615 406867690 0 5230
4 TraesCS2A01G090700 chr6B 99.009 2926 25 4 1 2924 408661943 408664866 0 5240
5 TraesCS2A01G090700 chr6B 98.805 2928 29 6 1 2924 704850703 704847778 0 5208
6 TraesCS2A01G090700 chr7B 99.009 2926 24 5 1 2924 528879484 528882406 0 5238
7 TraesCS2A01G090700 chr4B 98.600 2929 35 6 1 2924 194219138 194222065 0 5177
8 TraesCS2A01G090700 chr7A 98.361 2928 25 9 1 2924 171418632 171421540 0 5120
9 TraesCS2A01G090700 chr1A 99.142 2332 18 2 594 2924 567477552 567475222 0 4194


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G090700 chr2A 43380271 43383194 2923 False 5400 5400 100.000 1 2924 1 chr2A.!!$F1 2923
1 TraesCS2A01G090700 chr2A 719453777 719456699 2922 False 5238 5238 99.009 1 2924 1 chr2A.!!$F2 2923
2 TraesCS2A01G090700 chr5B 179227002 179229924 2922 False 5243 5243 99.043 1 2924 1 chr5B.!!$F1 2923
3 TraesCS2A01G090700 chr5B 406867690 406870615 2925 True 5230 5230 98.941 1 2924 1 chr5B.!!$R1 2923
4 TraesCS2A01G090700 chr6B 408661943 408664866 2923 False 5240 5240 99.009 1 2924 1 chr6B.!!$F1 2923
5 TraesCS2A01G090700 chr6B 704847778 704850703 2925 True 5208 5208 98.805 1 2924 1 chr6B.!!$R1 2923
6 TraesCS2A01G090700 chr7B 528879484 528882406 2922 False 5238 5238 99.009 1 2924 1 chr7B.!!$F1 2923
7 TraesCS2A01G090700 chr4B 194219138 194222065 2927 False 5177 5177 98.600 1 2924 1 chr4B.!!$F1 2923
8 TraesCS2A01G090700 chr7A 171418632 171421540 2908 False 5120 5120 98.361 1 2924 1 chr7A.!!$F1 2923
9 TraesCS2A01G090700 chr1A 567475222 567477552 2330 True 4194 4194 99.142 594 2924 1 chr1A.!!$R1 2330

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
918 927 6.660521 TCTTATCATTCAGTTGTGATTGCCTT 59.339 34.615 0.0 0.0 36.53 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2257 2268 7.118723 AGGCATTTTCATCCTAATGTACAAGA 58.881 34.615 0.0 0.0 34.88 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
122 127 7.504403 TGATGGAAAAGCAACTTGGAATAAAA 58.496 30.769 0.00 0.00 0.00 1.52
123 128 7.440856 TGATGGAAAAGCAACTTGGAATAAAAC 59.559 33.333 0.00 0.00 0.00 2.43
169 174 8.845227 TGTGAAGAAGCAAGTGATGTATAAAAA 58.155 29.630 0.00 0.00 0.00 1.94
224 230 7.339721 TGGTACTTTTATTCACCAGTGACAAAA 59.660 33.333 14.23 14.23 39.66 2.44
808 817 6.889301 AAACAGATGCTCAAAAGAAGATGA 57.111 33.333 0.00 0.00 0.00 2.92
918 927 6.660521 TCTTATCATTCAGTTGTGATTGCCTT 59.339 34.615 0.00 0.00 36.53 4.35
1069 1078 3.895656 AGTGAACTCTACACAACAGGCTA 59.104 43.478 0.00 0.00 40.25 3.93
1081 1090 5.221843 ACACAACAGGCTACTCAAAATCCTA 60.222 40.000 0.00 0.00 0.00 2.94
1263 1272 3.226777 TGTTGGTAATGGTTTGACAGGG 58.773 45.455 0.00 0.00 0.00 4.45
1382 1391 2.657143 TGCATATGCCTTGCAGATTGA 58.343 42.857 24.54 0.00 44.73 2.57
2257 2268 5.108517 CCTGCATGTTTGTTGTGTTAGTTT 58.891 37.500 0.00 0.00 0.00 2.66
2410 2424 6.957920 TTGACTTCATTTTGACTCCATTGA 57.042 33.333 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
122 127 4.263506 ACAATAGCTTTCTTGCCTACCTGT 60.264 41.667 0.00 0.00 0.00 4.00
123 128 4.095483 CACAATAGCTTTCTTGCCTACCTG 59.905 45.833 0.00 0.00 0.00 4.00
224 230 9.826574 GGAAAGGTAAATTAAACCTCACTTTTT 57.173 29.630 11.73 3.36 46.85 1.94
918 927 6.600032 TGTCAAGCAAGTAAGAAACTAAACCA 59.400 34.615 0.00 0.00 37.50 3.67
1069 1078 5.704053 CACCGGTTAACTTAGGATTTTGAGT 59.296 40.000 2.97 0.00 0.00 3.41
1081 1090 4.776308 AGTAGGAGAATCACCGGTTAACTT 59.224 41.667 2.97 0.00 36.25 2.66
1263 1272 5.531634 TCTTCATCATTTTCAGCACCAAAC 58.468 37.500 0.00 0.00 0.00 2.93
2257 2268 7.118723 AGGCATTTTCATCCTAATGTACAAGA 58.881 34.615 0.00 0.00 34.88 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.