Multiple sequence alignment - TraesCS2A01G081700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G081700 chr2A 100.000 2998 0 0 1 2998 36902649 36905646 0.000000e+00 5537
1 TraesCS2A01G081700 chr2A 97.582 3019 50 8 1 2998 705954883 705957899 0.000000e+00 5149
2 TraesCS2A01G081700 chr6A 97.781 3020 45 7 1 2998 60405406 60408425 0.000000e+00 5186
3 TraesCS2A01G081700 chr7A 97.714 3018 48 6 1 2998 419034988 419031972 0.000000e+00 5171
4 TraesCS2A01G081700 chr6B 82.216 1164 168 25 1244 2378 664382512 664381359 0.000000e+00 966
5 TraesCS2A01G081700 chr6B 83.874 1048 119 21 1 1006 664383604 664382565 0.000000e+00 953
6 TraesCS2A01G081700 chr6B 88.200 500 53 3 2503 2996 664381318 664380819 2.570000e-165 592


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G081700 chr2A 36902649 36905646 2997 False 5537 5537 100.000000 1 2998 1 chr2A.!!$F1 2997
1 TraesCS2A01G081700 chr2A 705954883 705957899 3016 False 5149 5149 97.582000 1 2998 1 chr2A.!!$F2 2997
2 TraesCS2A01G081700 chr6A 60405406 60408425 3019 False 5186 5186 97.781000 1 2998 1 chr6A.!!$F1 2997
3 TraesCS2A01G081700 chr7A 419031972 419034988 3016 True 5171 5171 97.714000 1 2998 1 chr7A.!!$R1 2997
4 TraesCS2A01G081700 chr6B 664380819 664383604 2785 True 837 966 84.763333 1 2996 3 chr6B.!!$R1 2995

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
415 456 3.979911 TCCTTAACCGTGTATCCCACTA 58.020 45.455 0.0 0.0 42.2 2.74 F
1686 1752 1.078988 GCCGTCAATTACCCCGTCA 60.079 57.895 0.0 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1979 2046 2.279741 CTTCAAGCTAACGCCATGCTA 58.720 47.619 0.0 0.0 35.85 3.49 R
2886 2976 0.464036 ACCAAGACGAGCAACTCACA 59.536 50.000 0.0 0.0 0.00 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
262 278 4.547671 CCACTTTCCCTCCTCATCTACTA 58.452 47.826 0.00 0.00 0.00 1.82
383 420 7.385267 CCCCATTTTCATATCAACACTGAAAA 58.615 34.615 10.89 10.89 46.76 2.29
415 456 3.979911 TCCTTAACCGTGTATCCCACTA 58.020 45.455 0.00 0.00 42.20 2.74
427 468 6.228258 GTGTATCCCACTAAGAAACAAGTCA 58.772 40.000 0.00 0.00 41.11 3.41
1036 1081 2.319844 TCGATCTACAGGATGCCACAT 58.680 47.619 0.00 0.00 42.53 3.21
1127 1172 8.729805 TCAGAAACAATGCATTTAACCTTTTT 57.270 26.923 9.83 1.08 0.00 1.94
1530 1595 5.992829 ACACACCACATTAGACATTCGTAAA 59.007 36.000 0.00 0.00 0.00 2.01
1686 1752 1.078988 GCCGTCAATTACCCCGTCA 60.079 57.895 0.00 0.00 0.00 4.35
1979 2046 3.275617 TGCCCTAACACAGCGATATTT 57.724 42.857 0.00 0.00 0.00 1.40
2057 2124 7.649705 ACGAGATAATGTAAGACATCACATCAC 59.350 37.037 0.00 0.00 37.97 3.06
2269 2343 7.278868 AGCTAAATAATGTACTTGAGTGTCAGC 59.721 37.037 0.00 0.00 0.00 4.26
2555 2639 4.274147 ACATCTGTCGTTCTCTATCCACT 58.726 43.478 0.00 0.00 0.00 4.00
2826 2916 1.377994 CCTCCAGGACAAGCTGCTT 59.622 57.895 9.53 9.53 37.39 3.91
2843 2933 2.014068 GCTTTGCTTGCTAGGGTCGAT 61.014 52.381 0.00 0.00 0.00 3.59
2886 2976 3.014304 ACATCCTTGCATCTGAAGCAT 57.986 42.857 8.51 0.00 42.33 3.79
2915 3005 1.889829 CTCGTCTTGGTCAGAGGTCTT 59.110 52.381 0.00 0.00 38.39 3.01
2921 3011 0.469331 TGGTCAGAGGTCTTGACGGT 60.469 55.000 0.00 0.00 33.72 4.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
262 278 0.614979 AGAGGGAGTGTATGCCGTGT 60.615 55.000 0.0 0.0 46.07 4.49
1036 1081 9.391006 GTACCAGAAAGATATGTTGATTAACCA 57.609 33.333 0.0 0.0 35.92 3.67
1979 2046 2.279741 CTTCAAGCTAACGCCATGCTA 58.720 47.619 0.0 0.0 35.85 3.49
2555 2639 9.342308 GAAAAATCTATCTGGTCAATGTCCATA 57.658 33.333 0.0 0.0 34.26 2.74
2826 2916 0.613260 ACATCGACCCTAGCAAGCAA 59.387 50.000 0.0 0.0 0.00 3.91
2886 2976 0.464036 ACCAAGACGAGCAACTCACA 59.536 50.000 0.0 0.0 0.00 3.58
2915 3005 0.679505 CAGAGAAGAACCCACCGTCA 59.320 55.000 0.0 0.0 0.00 4.35
2921 3011 1.971357 GGACAGACAGAGAAGAACCCA 59.029 52.381 0.0 0.0 0.00 4.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.