Multiple sequence alignment - TraesCS2A01G060100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G060100 chr2A 100.000 2798 0 0 1 2798 26865041 26867838 0.000000e+00 5168
1 TraesCS2A01G060100 chr2A 90.413 1356 73 19 982 2320 770397470 770398785 0.000000e+00 1731
2 TraesCS2A01G060100 chr2D 95.879 2815 68 26 1 2795 24487167 24489953 0.000000e+00 4512
3 TraesCS2A01G060100 chr2B 95.411 2811 85 25 1 2795 39940660 39943442 0.000000e+00 4436
4 TraesCS2A01G060100 chr7A 90.682 1363 72 20 982 2320 40374656 40375987 0.000000e+00 1762
5 TraesCS2A01G060100 chr3A 90.362 1380 67 21 982 2320 588540056 588538702 0.000000e+00 1751
6 TraesCS2A01G060100 chr3A 77.177 1573 340 18 436 2003 127820536 127822094 0.000000e+00 898
7 TraesCS2A01G060100 chr6D 77.278 1690 364 18 436 2117 452125850 452127527 0.000000e+00 976
8 TraesCS2A01G060100 chr3B 77.278 1690 365 17 436 2117 173005680 173007358 0.000000e+00 976
9 TraesCS2A01G060100 chr3B 76.738 1582 338 24 436 2005 172094501 172092938 0.000000e+00 856
10 TraesCS2A01G060100 chr3B 76.553 1578 345 22 436 2005 172213956 172212396 0.000000e+00 841
11 TraesCS2A01G060100 chr1D 77.954 1574 329 17 436 2003 341027818 341029379 0.000000e+00 968
12 TraesCS2A01G060100 chr1D 78.937 527 107 4 436 960 430228736 430228212 3.430000e-94 355
13 TraesCS2A01G060100 chr1D 93.846 65 4 0 339 403 480439046 480439110 6.380000e-17 99
14 TraesCS2A01G060100 chr1B 77.155 1694 360 25 436 2117 456712105 456713783 0.000000e+00 959
15 TraesCS2A01G060100 chr1B 85.885 503 53 10 1600 2095 668799189 668799680 1.150000e-143 520
16 TraesCS2A01G060100 chr1B 85.381 472 51 8 1631 2095 668777649 668778109 9.070000e-130 473
17 TraesCS2A01G060100 chr1B 81.928 498 29 15 957 1440 668765227 668765677 5.700000e-97 364
18 TraesCS2A01G060100 chr1B 95.455 132 6 0 1475 1606 668765678 668765809 7.850000e-51 211
19 TraesCS2A01G060100 chr1B 81.250 272 22 13 187 449 668764948 668765199 2.840000e-45 193
20 TraesCS2A01G060100 chr3D 76.923 1690 371 17 436 2117 121339821 121341499 0.000000e+00 942
21 TraesCS2A01G060100 chr3D 76.741 1694 366 26 436 2117 120144632 120142955 0.000000e+00 920
22 TraesCS2A01G060100 chr3D 77.387 995 209 14 436 1424 120133729 120132745 6.720000e-161 577
23 TraesCS2A01G060100 chr1A 86.158 354 27 6 1088 1430 576784525 576784867 2.050000e-96 363


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G060100 chr2A 26865041 26867838 2797 False 5168 5168 100.000 1 2798 1 chr2A.!!$F1 2797
1 TraesCS2A01G060100 chr2A 770397470 770398785 1315 False 1731 1731 90.413 982 2320 1 chr2A.!!$F2 1338
2 TraesCS2A01G060100 chr2D 24487167 24489953 2786 False 4512 4512 95.879 1 2795 1 chr2D.!!$F1 2794
3 TraesCS2A01G060100 chr2B 39940660 39943442 2782 False 4436 4436 95.411 1 2795 1 chr2B.!!$F1 2794
4 TraesCS2A01G060100 chr7A 40374656 40375987 1331 False 1762 1762 90.682 982 2320 1 chr7A.!!$F1 1338
5 TraesCS2A01G060100 chr3A 588538702 588540056 1354 True 1751 1751 90.362 982 2320 1 chr3A.!!$R1 1338
6 TraesCS2A01G060100 chr3A 127820536 127822094 1558 False 898 898 77.177 436 2003 1 chr3A.!!$F1 1567
7 TraesCS2A01G060100 chr6D 452125850 452127527 1677 False 976 976 77.278 436 2117 1 chr6D.!!$F1 1681
8 TraesCS2A01G060100 chr3B 173005680 173007358 1678 False 976 976 77.278 436 2117 1 chr3B.!!$F1 1681
9 TraesCS2A01G060100 chr3B 172092938 172094501 1563 True 856 856 76.738 436 2005 1 chr3B.!!$R1 1569
10 TraesCS2A01G060100 chr3B 172212396 172213956 1560 True 841 841 76.553 436 2005 1 chr3B.!!$R2 1569
11 TraesCS2A01G060100 chr1D 341027818 341029379 1561 False 968 968 77.954 436 2003 1 chr1D.!!$F1 1567
12 TraesCS2A01G060100 chr1D 430228212 430228736 524 True 355 355 78.937 436 960 1 chr1D.!!$R1 524
13 TraesCS2A01G060100 chr1B 456712105 456713783 1678 False 959 959 77.155 436 2117 1 chr1B.!!$F1 1681
14 TraesCS2A01G060100 chr1B 668764948 668765809 861 False 256 364 86.211 187 1606 3 chr1B.!!$F4 1419
15 TraesCS2A01G060100 chr3D 121339821 121341499 1678 False 942 942 76.923 436 2117 1 chr3D.!!$F1 1681
16 TraesCS2A01G060100 chr3D 120142955 120144632 1677 True 920 920 76.741 436 2117 1 chr3D.!!$R2 1681
17 TraesCS2A01G060100 chr3D 120132745 120133729 984 True 577 577 77.387 436 1424 1 chr3D.!!$R1 988

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
174 181 0.179073 AATCCTCGTCCATGGAAGCG 60.179 55.000 21.55 18.94 35.81 4.68 F
1257 1288 1.215382 CACGTCCATCTTCTGGCGA 59.785 57.895 12.63 0.00 45.52 5.54 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1257 1288 3.064324 GCGGCCTTCCAGTGCATT 61.064 61.111 0.0 0.0 0.0 3.56 R
2752 2859 0.179089 CGTGAAGCCTCCATCCAGAG 60.179 60.000 0.0 0.0 0.0 3.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 53 3.801050 CGAGATAACTTGCCTCATCACAG 59.199 47.826 0.00 0.00 0.00 3.66
77 80 1.529438 CCGTAGCAAAGTTCTCGCAAA 59.471 47.619 0.00 0.00 0.00 3.68
78 81 2.560896 CGTAGCAAAGTTCTCGCAAAC 58.439 47.619 0.00 0.00 0.00 2.93
79 82 2.221055 CGTAGCAAAGTTCTCGCAAACT 59.779 45.455 0.00 0.00 41.20 2.66
80 83 3.427528 CGTAGCAAAGTTCTCGCAAACTA 59.572 43.478 3.17 0.00 38.52 2.24
81 84 4.091509 CGTAGCAAAGTTCTCGCAAACTAT 59.908 41.667 3.17 0.00 38.52 2.12
82 85 4.410492 AGCAAAGTTCTCGCAAACTATG 57.590 40.909 3.17 0.00 38.52 2.23
83 86 3.815401 AGCAAAGTTCTCGCAAACTATGT 59.185 39.130 3.17 0.00 38.52 2.29
84 87 4.994852 AGCAAAGTTCTCGCAAACTATGTA 59.005 37.500 3.17 0.00 38.52 2.29
150 157 5.344743 TCCTAGATGTTTTGCCTCAGTAG 57.655 43.478 0.00 0.00 0.00 2.57
174 181 0.179073 AATCCTCGTCCATGGAAGCG 60.179 55.000 21.55 18.94 35.81 4.68
1257 1288 1.215382 CACGTCCATCTTCTGGCGA 59.785 57.895 12.63 0.00 45.52 5.54
1278 1309 4.785453 CACTGGAAGGCCGCCTCC 62.785 72.222 13.72 15.68 39.30 4.30
2140 2201 1.447317 AAATCCATCCATCCACGCGC 61.447 55.000 5.73 0.00 0.00 6.86
2141 2202 2.607411 AATCCATCCATCCACGCGCA 62.607 55.000 5.73 0.00 0.00 6.09
2142 2203 3.274586 CCATCCATCCACGCGCAG 61.275 66.667 5.73 2.42 0.00 5.18
2143 2204 2.202919 CATCCATCCACGCGCAGA 60.203 61.111 5.73 2.82 0.00 4.26
2144 2205 2.107750 ATCCATCCACGCGCAGAG 59.892 61.111 5.73 0.00 0.00 3.35
2189 2283 4.091945 TCAAGAAGACGCAAGAATCAATCG 59.908 41.667 0.00 0.00 43.62 3.34
2205 2299 3.686241 TCAATCGACAGCTCAAGAAATGG 59.314 43.478 0.00 0.00 0.00 3.16
2630 2730 1.997669 CCGTGCTGTAGTCCTTCTTC 58.002 55.000 0.00 0.00 0.00 2.87
2661 2761 4.649310 TACGAGCGTGCGTGGCAA 62.649 61.111 13.55 0.00 45.23 4.52
2795 2902 2.961062 GTCGCGGTGGGGGTATATATAT 59.039 50.000 6.13 0.00 0.00 0.86
2796 2903 4.144297 GTCGCGGTGGGGGTATATATATA 58.856 47.826 6.13 0.00 0.00 0.86
2797 2904 4.217118 GTCGCGGTGGGGGTATATATATAG 59.783 50.000 6.13 0.00 0.00 1.31
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 53 0.310854 AACTTTGCTACGGCTTGTGC 59.689 50.000 0.00 0.0 39.59 4.57
77 80 8.730680 CATGGTTCTGCTTTACTTTTACATAGT 58.269 33.333 0.00 0.0 0.00 2.12
78 81 7.698130 GCATGGTTCTGCTTTACTTTTACATAG 59.302 37.037 0.00 0.0 39.12 2.23
79 82 7.535139 GCATGGTTCTGCTTTACTTTTACATA 58.465 34.615 0.00 0.0 39.12 2.29
80 83 6.389906 GCATGGTTCTGCTTTACTTTTACAT 58.610 36.000 0.00 0.0 39.12 2.29
81 84 5.768317 GCATGGTTCTGCTTTACTTTTACA 58.232 37.500 0.00 0.0 39.12 2.41
1257 1288 3.064324 GCGGCCTTCCAGTGCATT 61.064 61.111 0.00 0.0 0.00 3.56
2140 2201 6.250344 TGTTGATTGATTCTTTCTGCTCTG 57.750 37.500 0.00 0.0 0.00 3.35
2141 2202 5.106237 GCTGTTGATTGATTCTTTCTGCTCT 60.106 40.000 0.00 0.0 0.00 4.09
2142 2203 5.094134 GCTGTTGATTGATTCTTTCTGCTC 58.906 41.667 0.00 0.0 0.00 4.26
2143 2204 4.765856 AGCTGTTGATTGATTCTTTCTGCT 59.234 37.500 0.00 0.0 0.00 4.24
2144 2205 5.056894 AGCTGTTGATTGATTCTTTCTGC 57.943 39.130 0.00 0.0 0.00 4.26
2189 2283 3.364366 CGTCAACCATTTCTTGAGCTGTC 60.364 47.826 0.00 0.0 0.00 3.51
2205 2299 3.681897 TCTCTCTAGTAACCGTCGTCAAC 59.318 47.826 0.00 0.0 0.00 3.18
2329 2429 3.998672 TCACCGTCGTTCCCTGCC 61.999 66.667 0.00 0.0 0.00 4.85
2336 2436 2.641559 GACCTCGTCACCGTCGTT 59.358 61.111 0.00 0.0 35.01 3.85
2337 2437 3.720193 CGACCTCGTCACCGTCGT 61.720 66.667 0.00 0.0 43.29 4.34
2592 2692 1.153568 CGATCCTGGAGCGCAAGAA 60.154 57.895 22.15 0.0 34.07 2.52
2752 2859 0.179089 CGTGAAGCCTCCATCCAGAG 60.179 60.000 0.00 0.0 0.00 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.