Multiple sequence alignment - TraesCS2A01G059000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G059000 chr2A 100.000 3041 0 0 1 3041 25039913 25036873 0.000000e+00 5616.0
1 TraesCS2A01G059000 chr2A 81.778 675 123 0 2367 3041 751722128 751722802 1.580000e-157 566.0
2 TraesCS2A01G059000 chr6B 99.408 3041 17 1 1 3041 25957562 25960601 0.000000e+00 5515.0
3 TraesCS2A01G059000 chr6D 99.043 1672 15 1 1370 3041 5494961 5496631 0.000000e+00 2998.0
4 TraesCS2A01G059000 chr6D 98.344 966 16 0 420 1385 5493964 5494929 0.000000e+00 1696.0
5 TraesCS2A01G059000 chr6D 97.837 416 9 0 1 416 5493501 5493916 0.000000e+00 719.0
6 TraesCS2A01G059000 chr3B 99.246 663 5 0 420 1082 22075835 22075173 0.000000e+00 1197.0
7 TraesCS2A01G059000 chr3B 98.798 416 5 0 1 416 22076298 22075883 0.000000e+00 741.0
8 TraesCS2A01G059000 chr3B 100.000 142 0 0 2900 3041 22075175 22075034 2.330000e-66 263.0
9 TraesCS2A01G059000 chr3B 72.494 389 94 11 980 1363 125866249 125866629 2.480000e-21 113.0
10 TraesCS2A01G059000 chr1B 99.246 663 4 1 420 1082 7414532 7415193 0.000000e+00 1195.0
11 TraesCS2A01G059000 chr1B 98.561 417 5 1 1 416 7414068 7414484 0.000000e+00 736.0
12 TraesCS2A01G059000 chr1B 100.000 142 0 0 2900 3041 7415191 7415332 2.330000e-66 263.0
13 TraesCS2A01G059000 chr4D 99.345 458 3 0 2579 3036 430796499 430796956 0.000000e+00 830.0
14 TraesCS2A01G059000 chr1A 83.255 639 101 6 2367 3002 52566309 52566944 1.570000e-162 582.0
15 TraesCS2A01G059000 chr1A 82.704 636 105 5 2367 3000 52561325 52560693 7.360000e-156 560.0
16 TraesCS2A01G059000 chr5A 79.972 714 95 33 42 726 546792830 546792136 1.640000e-132 483.0
17 TraesCS2A01G059000 chr5A 72.895 380 90 11 989 1363 694511823 694511452 5.330000e-23 119.0
18 TraesCS2A01G059000 chr7A 86.170 376 52 0 2625 3000 208088988 208089363 1.020000e-109 407.0
19 TraesCS2A01G059000 chr5B 78.884 251 51 2 1772 2021 70441053 70441302 5.210000e-38 169.0
20 TraesCS2A01G059000 chr1D 72.895 380 90 11 989 1363 172863844 172863473 5.330000e-23 119.0
21 TraesCS2A01G059000 chr2B 72.632 380 91 11 989 1363 777556645 777556274 2.480000e-21 113.0
22 TraesCS2A01G059000 chrUn 81.651 109 16 4 986 1092 74787545 74787651 1.500000e-13 87.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G059000 chr2A 25036873 25039913 3040 True 5616.000000 5616 100.000 1 3041 1 chr2A.!!$R1 3040
1 TraesCS2A01G059000 chr2A 751722128 751722802 674 False 566.000000 566 81.778 2367 3041 1 chr2A.!!$F1 674
2 TraesCS2A01G059000 chr6B 25957562 25960601 3039 False 5515.000000 5515 99.408 1 3041 1 chr6B.!!$F1 3040
3 TraesCS2A01G059000 chr6D 5493501 5496631 3130 False 1804.333333 2998 98.408 1 3041 3 chr6D.!!$F1 3040
4 TraesCS2A01G059000 chr3B 22075034 22076298 1264 True 733.666667 1197 99.348 1 3041 3 chr3B.!!$R1 3040
5 TraesCS2A01G059000 chr1B 7414068 7415332 1264 False 731.333333 1195 99.269 1 3041 3 chr1B.!!$F1 3040
6 TraesCS2A01G059000 chr1A 52566309 52566944 635 False 582.000000 582 83.255 2367 3002 1 chr1A.!!$F1 635
7 TraesCS2A01G059000 chr1A 52560693 52561325 632 True 560.000000 560 82.704 2367 3000 1 chr1A.!!$R1 633
8 TraesCS2A01G059000 chr5A 546792136 546792830 694 True 483.000000 483 79.972 42 726 1 chr5A.!!$R1 684

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
932 1003 7.355017 ACTTGCATAATATACAAGAATGTGCG 58.645 34.615 17.47 0.0 42.71 5.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2570 2688 1.398692 ATCCGTGGCTTGTTGTGTTT 58.601 45.0 0.0 0.0 0.0 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
932 1003 7.355017 ACTTGCATAATATACAAGAATGTGCG 58.645 34.615 17.47 0.0 42.71 5.34
2160 2278 9.834628 GAGATGATAAACTAGTCATGTAGTAGC 57.165 37.037 0.00 0.0 35.33 3.58
2570 2688 3.753797 TGTAGGCGTATGAAATTGTGCAA 59.246 39.130 0.00 0.0 0.00 4.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
932 1003 7.533426 TGACTCGAATTTAACTACAGTAGACC 58.467 38.462 14.94 0.0 0.0 3.85
1454 1572 2.287668 CGAGATCTTCCTTCGGCGTAAT 60.288 50.000 6.85 0.0 0.0 1.89
2160 2278 6.428159 ACAGAGGTCTAGTAAACAAAAGCATG 59.572 38.462 0.00 0.0 0.0 4.06
2570 2688 1.398692 ATCCGTGGCTTGTTGTGTTT 58.601 45.000 0.00 0.0 0.0 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.