Multiple sequence alignment - TraesCS2A01G054500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G054500 chr2A 100.000 2288 0 0 1 2288 22802294 22800007 0 4226
1 TraesCS2A01G054500 chr2A 99.389 2291 11 3 1 2288 22939383 22937093 0 4150
2 TraesCS2A01G054500 chr2A 99.345 2291 12 2 1 2288 22651565 22653855 0 4145
3 TraesCS2A01G054500 chr2A 99.302 2291 13 2 1 2288 22619183 22621473 0 4139
4 TraesCS2A01G054500 chr2A 99.525 631 3 0 1 631 23190502 23191132 0 1149
5 TraesCS2A01G054500 chrUn 99.432 2289 11 2 1 2288 146913735 146911448 0 4154
6 TraesCS2A01G054500 chrUn 99.301 2289 14 2 1 2288 210798871 210801158 0 4137
7 TraesCS2A01G054500 chrUn 99.301 2289 13 3 1 2288 154083935 154081649 0 4135
8 TraesCS2A01G054500 chrUn 99.084 2293 15 3 1 2288 146898763 146896472 0 4113
9 TraesCS2A01G054500 chrUn 99.039 2290 18 3 1 2288 154097099 154094812 0 4104
10 TraesCS2A01G054500 chrUn 99.313 1746 9 3 544 2288 252346159 252347902 0 3155


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G054500 chr2A 22800007 22802294 2287 True 4226 4226 100.000 1 2288 1 chr2A.!!$R1 2287
1 TraesCS2A01G054500 chr2A 22937093 22939383 2290 True 4150 4150 99.389 1 2288 1 chr2A.!!$R2 2287
2 TraesCS2A01G054500 chr2A 22651565 22653855 2290 False 4145 4145 99.345 1 2288 1 chr2A.!!$F2 2287
3 TraesCS2A01G054500 chr2A 22619183 22621473 2290 False 4139 4139 99.302 1 2288 1 chr2A.!!$F1 2287
4 TraesCS2A01G054500 chr2A 23190502 23191132 630 False 1149 1149 99.525 1 631 1 chr2A.!!$F3 630
5 TraesCS2A01G054500 chrUn 146911448 146913735 2287 True 4154 4154 99.432 1 2288 1 chrUn.!!$R2 2287
6 TraesCS2A01G054500 chrUn 210798871 210801158 2287 False 4137 4137 99.301 1 2288 1 chrUn.!!$F1 2287
7 TraesCS2A01G054500 chrUn 154081649 154083935 2286 True 4135 4135 99.301 1 2288 1 chrUn.!!$R3 2287
8 TraesCS2A01G054500 chrUn 146896472 146898763 2291 True 4113 4113 99.084 1 2288 1 chrUn.!!$R1 2287
9 TraesCS2A01G054500 chrUn 154094812 154097099 2287 True 4104 4104 99.039 1 2288 1 chrUn.!!$R4 2287
10 TraesCS2A01G054500 chrUn 252346159 252347902 1743 False 3155 3155 99.313 544 2288 1 chrUn.!!$F2 1744

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
782 787 2.02893 GGGAAGTTGATCTCACTGTCGT 60.029 50.0 0.0 0.0 0.0 4.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1863 1869 4.442472 GCTCCTTGTATAGGTCGCCTTTAA 60.442 45.833 3.71 0.0 45.03 1.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
493 498 5.418676 CAACACAAACAAGGGATTCAAAGT 58.581 37.500 0.00 0.0 0.00 2.66
524 529 7.180946 TCCATGAGAGTTCTTTCTTCTGGATTA 59.819 37.037 0.00 0.0 35.17 1.75
782 787 2.028930 GGGAAGTTGATCTCACTGTCGT 60.029 50.000 0.00 0.0 0.00 4.34
910 915 3.901844 TGGAGTCAAGCTACCCATATACC 59.098 47.826 0.00 0.0 0.00 2.73
1863 1869 2.993937 TCGCCATAAACCCGATTCTTT 58.006 42.857 0.00 0.0 0.00 2.52
2189 2196 2.214347 CATCAAGATGCAGCTCTCCAG 58.786 52.381 4.22 0.0 31.39 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
524 529 7.363268 GCATCCAAACTCAAATTCTCATACCTT 60.363 37.037 0.00 0.00 0.00 3.50
782 787 3.133901 TCACAGTCAACCAACTCTTGCTA 59.866 43.478 0.00 0.00 0.00 3.49
910 915 4.081030 CACTTGCCGTCAGCTGCG 62.081 66.667 19.36 19.36 44.23 5.18
1863 1869 4.442472 GCTCCTTGTATAGGTCGCCTTTAA 60.442 45.833 3.71 0.00 45.03 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.