Multiple sequence alignment - TraesCS2A01G020700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G020700 chr2A 100.000 2480 0 0 1 2480 9840709 9843188 0.000000e+00 4580
1 TraesCS2A01G020700 chr2A 98.548 2411 18 8 81 2480 9388008 9390412 0.000000e+00 4242
2 TraesCS2A01G020700 chr2A 93.361 964 50 6 619 1579 21274719 21273767 0.000000e+00 1413
3 TraesCS2A01G020700 chr2A 93.226 620 38 4 1 619 744077249 744076633 0.000000e+00 909
4 TraesCS2A01G020700 chr2A 90.687 655 49 9 1612 2262 21273765 21273119 0.000000e+00 861
5 TraesCS2A01G020700 chr2A 82.827 658 83 11 887 1534 682634554 682633917 1.670000e-156 562
6 TraesCS2A01G020700 chr2A 84.926 272 31 8 2132 2397 15610792 15611059 1.460000e-67 267
7 TraesCS2A01G020700 chr2A 83.462 260 41 2 2136 2393 62388300 62388041 8.860000e-60 241
8 TraesCS2A01G020700 chr2D 92.283 933 59 6 619 1551 9883747 9882828 0.000000e+00 1312
9 TraesCS2A01G020700 chr2D 88.523 819 73 15 1612 2420 9882638 9881831 0.000000e+00 972
10 TraesCS2A01G020700 chr2D 83.969 262 36 5 2136 2393 62063203 62062944 1.900000e-61 246
11 TraesCS2A01G020700 chr7A 95.000 620 28 3 1 619 77165472 77164855 0.000000e+00 970
12 TraesCS2A01G020700 chr7A 93.700 619 35 3 1 619 257150418 257151032 0.000000e+00 924
13 TraesCS2A01G020700 chr7A 93.376 619 38 3 1 619 648424355 648423740 0.000000e+00 913
14 TraesCS2A01G020700 chr7A 83.463 641 95 6 887 1525 181696886 181697517 9.880000e-164 586
15 TraesCS2A01G020700 chr7A 83.794 253 32 7 2149 2394 559203245 559202995 5.330000e-57 231
16 TraesCS2A01G020700 chr3A 94.184 619 34 1 1 619 30525201 30524585 0.000000e+00 942
17 TraesCS2A01G020700 chr3A 93.226 620 39 2 1 619 56723205 56722588 0.000000e+00 909
18 TraesCS2A01G020700 chr3A 78.583 621 92 23 887 1502 46583111 46582527 3.010000e-99 372
19 TraesCS2A01G020700 chr6A 93.548 620 39 1 1 619 18875082 18874463 0.000000e+00 922
20 TraesCS2A01G020700 chr6A 93.076 621 38 5 1 619 560446642 560446025 0.000000e+00 904
21 TraesCS2A01G020700 chr5A 93.215 619 41 1 1 619 546515056 546514439 0.000000e+00 909
22 TraesCS2A01G020700 chr7B 84.279 617 88 4 887 1502 143811062 143811670 5.910000e-166 593
23 TraesCS2A01G020700 chr7D 83.468 617 93 4 887 1502 177877596 177878204 1.290000e-157 566
24 TraesCS2A01G020700 chr2B 84.000 275 33 11 2132 2397 24241787 24242059 1.140000e-63 254
25 TraesCS2A01G020700 chr2B 85.039 254 31 7 2149 2396 680079990 680079738 4.090000e-63 252
26 TraesCS2A01G020700 chr2B 83.465 254 35 7 2149 2396 680078414 680078162 1.920000e-56 230
27 TraesCS2A01G020700 chr4D 82.443 262 40 6 2136 2393 380282218 380281959 8.930000e-55 224


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G020700 chr2A 9840709 9843188 2479 False 4580 4580 100.000 1 2480 1 chr2A.!!$F2 2479
1 TraesCS2A01G020700 chr2A 9388008 9390412 2404 False 4242 4242 98.548 81 2480 1 chr2A.!!$F1 2399
2 TraesCS2A01G020700 chr2A 21273119 21274719 1600 True 1137 1413 92.024 619 2262 2 chr2A.!!$R4 1643
3 TraesCS2A01G020700 chr2A 744076633 744077249 616 True 909 909 93.226 1 619 1 chr2A.!!$R3 618
4 TraesCS2A01G020700 chr2A 682633917 682634554 637 True 562 562 82.827 887 1534 1 chr2A.!!$R2 647
5 TraesCS2A01G020700 chr2D 9881831 9883747 1916 True 1142 1312 90.403 619 2420 2 chr2D.!!$R2 1801
6 TraesCS2A01G020700 chr7A 77164855 77165472 617 True 970 970 95.000 1 619 1 chr7A.!!$R1 618
7 TraesCS2A01G020700 chr7A 257150418 257151032 614 False 924 924 93.700 1 619 1 chr7A.!!$F2 618
8 TraesCS2A01G020700 chr7A 648423740 648424355 615 True 913 913 93.376 1 619 1 chr7A.!!$R3 618
9 TraesCS2A01G020700 chr7A 181696886 181697517 631 False 586 586 83.463 887 1525 1 chr7A.!!$F1 638
10 TraesCS2A01G020700 chr3A 30524585 30525201 616 True 942 942 94.184 1 619 1 chr3A.!!$R1 618
11 TraesCS2A01G020700 chr3A 56722588 56723205 617 True 909 909 93.226 1 619 1 chr3A.!!$R3 618
12 TraesCS2A01G020700 chr3A 46582527 46583111 584 True 372 372 78.583 887 1502 1 chr3A.!!$R2 615
13 TraesCS2A01G020700 chr6A 18874463 18875082 619 True 922 922 93.548 1 619 1 chr6A.!!$R1 618
14 TraesCS2A01G020700 chr6A 560446025 560446642 617 True 904 904 93.076 1 619 1 chr6A.!!$R2 618
15 TraesCS2A01G020700 chr5A 546514439 546515056 617 True 909 909 93.215 1 619 1 chr5A.!!$R1 618
16 TraesCS2A01G020700 chr7B 143811062 143811670 608 False 593 593 84.279 887 1502 1 chr7B.!!$F1 615
17 TraesCS2A01G020700 chr7D 177877596 177878204 608 False 566 566 83.468 887 1502 1 chr7D.!!$F1 615
18 TraesCS2A01G020700 chr2B 680078162 680079990 1828 True 241 252 84.252 2149 2396 2 chr2B.!!$R1 247

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
536 539 0.104304 GCGAAAATCGGGCTCCTAGA 59.896 55.0 1.64 0.0 40.84 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1922 2113 1.222936 GGTCTGGGTGGAGATGCTG 59.777 63.158 0.0 0.0 0.0 4.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
253 255 2.770048 CGAGGGAGGGCAAGGGAT 60.770 66.667 0.00 0.0 0.00 3.85
371 373 2.558554 AAACGAGGCGATGAGGACGG 62.559 60.000 0.00 0.0 0.00 4.79
536 539 0.104304 GCGAAAATCGGGCTCCTAGA 59.896 55.000 1.64 0.0 40.84 2.43
537 540 1.472728 GCGAAAATCGGGCTCCTAGAA 60.473 52.381 1.64 0.0 40.84 2.10
808 826 3.502123 TCCCCATCAGTTCGAACTTTT 57.498 42.857 27.79 15.2 37.08 2.27
1349 1379 2.750350 CCCTGGAGCCTTGTTCGT 59.250 61.111 0.00 0.0 0.00 3.85
2141 2336 4.348168 CCCATGGGGCATATATAGTACTCC 59.652 50.000 24.53 0.0 35.35 3.85
2142 2337 4.039245 CCATGGGGCATATATAGTACTCCG 59.961 50.000 2.85 0.0 0.00 4.63
2144 2339 4.275810 TGGGGCATATATAGTACTCCGTC 58.724 47.826 0.00 0.0 0.00 4.79
2146 2341 4.338682 GGGGCATATATAGTACTCCGTCTG 59.661 50.000 0.00 0.0 0.00 3.51
2147 2342 5.191426 GGGCATATATAGTACTCCGTCTGA 58.809 45.833 0.00 0.0 0.00 3.27
2150 2345 7.147880 GGGCATATATAGTACTCCGTCTGATTT 60.148 40.741 0.00 0.0 0.00 2.17
2151 2346 8.251721 GGCATATATAGTACTCCGTCTGATTTT 58.748 37.037 0.00 0.0 0.00 1.82
2294 2492 8.908786 ATGATTATAATGGTAGTGACTTGGTG 57.091 34.615 1.78 0.0 0.00 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
253 255 3.982372 GAAGACCGGATGACGCGCA 62.982 63.158 9.46 5.73 42.52 6.09
371 373 2.202810 CTCTTCTCGCCCCTTCGC 60.203 66.667 0.00 0.00 0.00 4.70
421 423 1.766069 GAACTGTTTTGGCGCGAAAT 58.234 45.000 18.45 2.90 0.00 2.17
536 539 2.094762 AAATCAGCCTAGTCGCGTTT 57.905 45.000 5.77 0.00 0.00 3.60
537 540 2.094762 AAAATCAGCCTAGTCGCGTT 57.905 45.000 5.77 0.00 0.00 4.84
808 826 6.016610 CAGTTCATCTAAAAGTCCGGGAAAAA 60.017 38.462 0.00 0.00 0.00 1.94
1349 1379 1.877576 AAGCTCCATCGTCGTGCTCA 61.878 55.000 0.00 0.00 33.10 4.26
1922 2113 1.222936 GGTCTGGGTGGAGATGCTG 59.777 63.158 0.00 0.00 0.00 4.41
2136 2331 7.148018 ACGGAGTAAATAAAATCAGACGGAGTA 60.148 37.037 0.00 0.00 40.88 2.59
2137 2332 6.350780 ACGGAGTAAATAAAATCAGACGGAGT 60.351 38.462 0.00 0.00 44.52 3.85
2139 2334 5.969423 ACGGAGTAAATAAAATCAGACGGA 58.031 37.500 0.00 0.00 41.94 4.69
2284 2482 1.405105 ACATGCACAACACCAAGTCAC 59.595 47.619 0.00 0.00 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.