Multiple sequence alignment - TraesCS2A01G020200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G020200 chr2A 100.000 2662 0 0 1 2662 9536127 9538788 0.000000e+00 4916.0
1 TraesCS2A01G020200 chr2A 98.390 2671 33 4 1 2662 9509938 9512607 0.000000e+00 4686.0
2 TraesCS2A01G020200 chr2A 98.127 2670 36 4 1 2662 8918259 8915596 0.000000e+00 4641.0
3 TraesCS2A01G020200 chr2A 97.471 2689 32 9 1 2662 9562356 9565035 0.000000e+00 4556.0
4 TraesCS2A01G020200 chr2A 96.253 934 34 1 1 934 9546930 9547862 0.000000e+00 1530.0
5 TraesCS2A01G020200 chr2A 96.039 934 36 1 1 934 9520705 9521637 0.000000e+00 1519.0
6 TraesCS2A01G020200 chr2A 95.824 934 38 1 1 934 9455217 9456149 0.000000e+00 1507.0
7 TraesCS2A01G020200 chr2A 95.624 937 37 4 1 934 8933769 8932834 0.000000e+00 1500.0
8 TraesCS2A01G020200 chr2A 94.737 38 2 0 1909 1946 8916313 8916276 2.860000e-05 60.2
9 TraesCS2A01G020200 chr2A 94.737 38 2 0 1946 1983 8916350 8916313 2.860000e-05 60.2
10 TraesCS2A01G020200 chr2A 94.737 38 2 0 1946 1983 9511853 9511890 2.860000e-05 60.2
11 TraesCS2A01G020200 chr2A 94.737 38 2 0 1909 1946 9511890 9511927 2.860000e-05 60.2
12 TraesCS2A01G020200 chr2A 94.737 38 2 0 1946 1983 9538035 9538072 2.860000e-05 60.2
13 TraesCS2A01G020200 chr2A 94.737 38 2 0 1909 1946 9538072 9538109 2.860000e-05 60.2
14 TraesCS2A01G020200 chr2A 94.737 38 2 0 1946 1983 9564281 9564318 2.860000e-05 60.2
15 TraesCS2A01G020200 chr4B 95.940 936 36 2 1 934 19511912 19510977 0.000000e+00 1517.0
16 TraesCS2A01G020200 chr7A 93.379 1027 44 4 934 1946 299324983 299323967 0.000000e+00 1498.0
17 TraesCS2A01G020200 chr7A 95.543 718 28 3 1948 2662 299324002 299323286 0.000000e+00 1146.0
18 TraesCS2A01G020200 chr7A 94.643 56 2 1 1545 1600 299324421 299324367 4.720000e-13 86.1
19 TraesCS2A01G020200 chrUn 95.508 935 39 3 1 933 217704422 217705355 0.000000e+00 1491.0
20 TraesCS2A01G020200 chrUn 95.508 935 39 3 1 933 217724084 217725017 0.000000e+00 1491.0
21 TraesCS2A01G020200 chr5A 88.889 747 27 21 1948 2662 659257640 659256918 0.000000e+00 869.0
22 TraesCS2A01G020200 chr5A 91.415 629 28 6 934 1547 659258567 659257950 0.000000e+00 839.0
23 TraesCS2A01G020200 chr5A 94.030 402 23 1 1545 1946 659258005 659257605 2.270000e-170 608.0
24 TraesCS2A01G020200 chr6B 90.476 630 33 6 934 1547 690478749 690478131 0.000000e+00 806.0
25 TraesCS2A01G020200 chr6B 94.243 469 25 2 2195 2662 690477770 690477303 0.000000e+00 715.0
26 TraesCS2A01G020200 chr6B 95.522 402 17 1 1545 1946 690478186 690477786 2.230000e-180 641.0
27 TraesCS2A01G020200 chr3A 83.095 349 52 5 1548 1890 60942662 60942315 7.160000e-81 311.0
28 TraesCS2A01G020200 chr4D 77.901 181 27 6 1314 1483 136965888 136965710 1.690000e-17 100.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G020200 chr2A 9536127 9538788 2661 False 1678.800000 4916 96.491333 1 2662 3 chr2A.!!$F5 2661
1 TraesCS2A01G020200 chr2A 9562356 9565035 2679 False 2308.100000 4556 96.104000 1 2662 2 chr2A.!!$F6 2661
2 TraesCS2A01G020200 chr2A 9509938 9512607 2669 False 1602.133333 4686 95.954667 1 2662 3 chr2A.!!$F4 2661
3 TraesCS2A01G020200 chr2A 8915596 8918259 2663 True 1587.133333 4641 95.867000 1 2662 3 chr2A.!!$R2 2661
4 TraesCS2A01G020200 chr2A 9546930 9547862 932 False 1530.000000 1530 96.253000 1 934 1 chr2A.!!$F3 933
5 TraesCS2A01G020200 chr2A 9520705 9521637 932 False 1519.000000 1519 96.039000 1 934 1 chr2A.!!$F2 933
6 TraesCS2A01G020200 chr2A 9455217 9456149 932 False 1507.000000 1507 95.824000 1 934 1 chr2A.!!$F1 933
7 TraesCS2A01G020200 chr2A 8932834 8933769 935 True 1500.000000 1500 95.624000 1 934 1 chr2A.!!$R1 933
8 TraesCS2A01G020200 chr4B 19510977 19511912 935 True 1517.000000 1517 95.940000 1 934 1 chr4B.!!$R1 933
9 TraesCS2A01G020200 chr7A 299323286 299324983 1697 True 910.033333 1498 94.521667 934 2662 3 chr7A.!!$R1 1728
10 TraesCS2A01G020200 chrUn 217704422 217705355 933 False 1491.000000 1491 95.508000 1 933 1 chrUn.!!$F1 932
11 TraesCS2A01G020200 chrUn 217724084 217725017 933 False 1491.000000 1491 95.508000 1 933 1 chrUn.!!$F2 932
12 TraesCS2A01G020200 chr5A 659256918 659258567 1649 True 772.000000 869 91.444667 934 2662 3 chr5A.!!$R1 1728
13 TraesCS2A01G020200 chr6B 690477303 690478749 1446 True 720.666667 806 93.413667 934 2662 3 chr6B.!!$R1 1728

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
979 995 1.827969 GTATCTGTGCTGGAGGTCAGT 59.172 52.381 0.0 0.0 45.08 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2324 2501 4.241555 GATGGCGCCATCTCCGGT 62.242 66.667 46.89 27.07 46.67 5.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
323 326 8.141909 CCAATACCTAGTTCAATCTCGTTATCA 58.858 37.037 0.00 0.00 0.00 2.15
819 826 7.688167 GTGACATTGTGTTTGTCTATGTATTCG 59.312 37.037 0.00 0.00 43.12 3.34
979 995 1.827969 GTATCTGTGCTGGAGGTCAGT 59.172 52.381 0.00 0.00 45.08 3.41
988 1004 3.235200 GCTGGAGGTCAGTGGTAGATAT 58.765 50.000 0.00 0.00 45.08 1.63
1294 1312 3.033909 AGGCTGTATGCATAGTGTCAGA 58.966 45.455 20.50 0.00 45.15 3.27
1527 1556 3.005684 TGACAAAGCATTTAAGGTGCCAG 59.994 43.478 10.28 4.97 43.50 4.85
1667 1751 0.905357 ATGAAGCGCTCTAGGTTGGT 59.095 50.000 12.06 0.00 31.35 3.67
1774 1866 1.568504 ATACCGGCAGGAACTCTTCA 58.431 50.000 10.86 0.00 41.02 3.02
1999 2091 3.636764 GGCAATCTGTGGTAAAATAGGGG 59.363 47.826 0.00 0.00 0.00 4.79
2022 2115 7.094205 GGGGAAATGCTCATAACTATGTATTGG 60.094 40.741 0.00 0.00 35.26 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
323 326 3.982058 CGAAACGAGTAAAGAGACTTGCT 59.018 43.478 0.00 0.00 34.59 3.91
608 614 9.565090 TGCTATTGCTTTCTTCATGACTTATAT 57.435 29.630 0.00 0.00 40.48 0.86
770 776 6.205853 CACTAGTATGCCTCTACTTGACTAGG 59.794 46.154 0.00 0.00 39.34 3.02
819 826 2.033299 CCCGGAAACATGATACATGTGC 59.967 50.000 16.29 11.88 31.80 4.57
988 1004 2.916703 GCACATGGGTTGGTGGCA 60.917 61.111 0.00 0.00 35.58 4.92
1294 1312 6.329496 TGCAGAGAACGAAATTTGTTTTCTT 58.671 32.000 14.33 1.30 38.34 2.52
1774 1866 5.964958 AAAATGATTCATCCACTGAACGT 57.035 34.783 0.00 0.00 46.37 3.99
1999 2091 9.056005 TGACCAATACATAGTTATGAGCATTTC 57.944 33.333 6.16 0.00 37.15 2.17
2324 2501 4.241555 GATGGCGCCATCTCCGGT 62.242 66.667 46.89 27.07 46.67 5.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.