Multiple sequence alignment - TraesCS2A01G019300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G019300 chr2A 100.000 3797 0 0 1 3797 8806209 8810005 0.000000e+00 7012.0
1 TraesCS2A01G019300 chr2A 99.684 2528 8 0 1270 3797 9648087 9645560 0.000000e+00 4625.0
2 TraesCS2A01G019300 chr2A 99.504 1209 3 1 1 1206 9659092 9657884 0.000000e+00 2196.0
3 TraesCS2A01G019300 chr2A 87.479 599 44 15 768 1354 10218106 10217527 0.000000e+00 662.0
4 TraesCS2A01G019300 chr2A 88.345 429 42 6 1488 1914 10217348 10216926 3.380000e-140 508.0
5 TraesCS2A01G019300 chr2A 90.580 276 21 2 34 304 10223655 10223380 1.000000e-95 361.0
6 TraesCS2A01G019300 chr2A 84.163 221 27 6 1691 1909 20593100 20593314 1.380000e-49 207.0
7 TraesCS2A01G019300 chr2A 89.024 164 12 5 1691 1850 20386093 20385932 8.320000e-47 198.0
8 TraesCS2A01G019300 chr2A 93.443 61 3 1 1390 1450 10217529 10217470 5.220000e-14 89.8
9 TraesCS2A01G019300 chr2A 88.406 69 8 0 2014 2082 10216793 10216725 2.430000e-12 84.2
10 TraesCS2A01G019300 chrUn 99.855 1384 1 1 1197 2579 371736465 371735082 0.000000e+00 2543.0
11 TraesCS2A01G019300 chrUn 94.000 50 2 1 683 731 371028760 371028711 1.460000e-09 75.0
12 TraesCS2A01G019300 chr2B 81.558 385 71 0 2413 2797 32124285 32123901 6.120000e-83 318.0
13 TraesCS2A01G019300 chr2B 86.911 191 20 4 1691 1878 32124903 32124715 3.840000e-50 209.0
14 TraesCS2A01G019300 chr2D 82.421 347 57 4 2459 2804 19561486 19561143 2.220000e-77 300.0
15 TraesCS2A01G019300 chr2D 86.911 191 20 5 1691 1878 19240473 19240285 3.840000e-50 209.0
16 TraesCS2A01G019300 chr2D 85.946 185 21 5 1697 1878 19533624 19533442 3.870000e-45 193.0
17 TraesCS2A01G019300 chr2D 81.982 222 25 9 1697 1912 19562949 19562737 1.400000e-39 174.0
18 TraesCS2A01G019300 chr2D 98.361 61 1 0 367 427 302248037 302248097 1.440000e-19 108.0
19 TraesCS2A01G019300 chr2D 81.295 139 21 5 1492 1629 354683111 354683245 1.440000e-19 108.0
20 TraesCS2A01G019300 chr2D 98.361 61 1 0 367 427 382455964 382456024 1.440000e-19 108.0
21 TraesCS2A01G019300 chr3D 82.927 205 22 7 1712 1912 589666566 589666761 5.040000e-39 172.0
22 TraesCS2A01G019300 chr3D 82.927 205 22 7 1712 1912 589710243 589710438 5.040000e-39 172.0
23 TraesCS2A01G019300 chr3D 98.361 61 1 0 367 427 66523439 66523379 1.440000e-19 108.0
24 TraesCS2A01G019300 chr5B 83.803 142 14 5 1488 1629 398350757 398350889 3.980000e-25 126.0
25 TraesCS2A01G019300 chr1B 95.522 67 2 1 367 433 151463459 151463394 5.190000e-19 106.0
26 TraesCS2A01G019300 chr4A 95.455 66 2 1 367 432 511040546 511040482 1.870000e-18 104.0
27 TraesCS2A01G019300 chr3B 95.455 66 2 1 367 432 450376582 450376646 1.870000e-18 104.0
28 TraesCS2A01G019300 chr4B 92.958 71 4 1 369 439 452720952 452721021 6.710000e-18 102.0
29 TraesCS2A01G019300 chr3A 89.873 79 5 3 367 445 538848726 538848801 8.680000e-17 99.0
30 TraesCS2A01G019300 chr5A 79.832 119 19 4 1493 1611 296199830 296199943 8.740000e-12 82.4
31 TraesCS2A01G019300 chr7A 94.000 50 2 1 683 731 707497804 707497755 1.460000e-09 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G019300 chr2A 8806209 8810005 3796 False 7012.0 7012 100.00000 1 3797 1 chr2A.!!$F1 3796
1 TraesCS2A01G019300 chr2A 9645560 9648087 2527 True 4625.0 4625 99.68400 1270 3797 1 chr2A.!!$R1 2527
2 TraesCS2A01G019300 chr2A 9657884 9659092 1208 True 2196.0 2196 99.50400 1 1206 1 chr2A.!!$R2 1205
3 TraesCS2A01G019300 chr2A 10216725 10218106 1381 True 336.0 662 89.41825 768 2082 4 chr2A.!!$R5 1314
4 TraesCS2A01G019300 chrUn 371735082 371736465 1383 True 2543.0 2543 99.85500 1197 2579 1 chrUn.!!$R2 1382
5 TraesCS2A01G019300 chr2B 32123901 32124903 1002 True 263.5 318 84.23450 1691 2797 2 chr2B.!!$R1 1106
6 TraesCS2A01G019300 chr2D 19561143 19562949 1806 True 237.0 300 82.20150 1697 2804 2 chr2D.!!$R3 1107

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
529 530 3.596214 AGGAGTTGTAACTTATGTGGCG 58.404 45.455 0.00 0.0 39.88 5.69 F
2709 3651 0.735632 CTGGAGCAGCGACAGACTTC 60.736 60.000 12.51 0.0 34.21 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2709 3651 0.958822 CCCCCTGGTCAAACTTTTCG 59.041 55.000 0.0 0.0 0.0 3.46 R
3599 4541 4.391830 GCACGAATTATCTCCACTGTTCAA 59.608 41.667 0.0 0.0 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 6.564709 ACAATGTTGTGGCAGCTATATATG 57.435 37.500 0.00 0.00 40.49 1.78
529 530 3.596214 AGGAGTTGTAACTTATGTGGCG 58.404 45.455 0.00 0.00 39.88 5.69
2709 3651 0.735632 CTGGAGCAGCGACAGACTTC 60.736 60.000 12.51 0.00 34.21 3.01
2877 3819 8.380743 TGCACATTTTTGCTGAATTTAGAATT 57.619 26.923 0.58 0.00 43.41 2.17
2986 3928 9.261180 GCTAGACATGTAGAAGTGCATAATTTA 57.739 33.333 0.00 0.00 0.00 1.40
3276 4218 3.982576 TTCCTTTCTTTTCGTCTTGGC 57.017 42.857 0.00 0.00 0.00 4.52
3576 4518 2.258013 GCACCGGCAAGCTTGTACA 61.258 57.895 26.55 0.00 40.72 2.90
3599 4541 1.339055 CCACACCCATCGTGATGAAGT 60.339 52.381 11.35 5.68 46.20 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 6.803807 GGGTACGAAACTATGAATACGATACC 59.196 42.308 0.00 0.00 32.56 2.73
529 530 1.468520 ACGCACCTGTTGAATATGTGC 59.531 47.619 11.18 11.18 46.60 4.57
2709 3651 0.958822 CCCCCTGGTCAAACTTTTCG 59.041 55.000 0.00 0.00 0.00 3.46
3276 4218 7.259882 ACAAACAATATGCAATATCCACACTG 58.740 34.615 0.00 0.00 38.94 3.66
3599 4541 4.391830 GCACGAATTATCTCCACTGTTCAA 59.608 41.667 0.00 0.00 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.