AutoCloner

Multiple sequence alignment - TraesCS1D01G449400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS1D01G449400	chr1D	100.000	3194	0	0	1	3194	491665809	491662616	0.000000e+00	5899
1	TraesCS1D01G449400	chr1D	83.160	1918	304	10	1	1915	491696378	491694477	0.000000e+00	1735
2	TraesCS1D01G449400	chr1D	83.128	1784	281	14	114	1891	491639173	491637404	0.000000e+00	1609
3	TraesCS1D01G449400	chr1D	81.867	1853	311	18	47	1891	491688236	491686401	0.000000e+00	1537
4	TraesCS1D01G449400	chr1D	84.264	197	31	0	1	197	491688353	491688157	3.250000e-45	193
5	TraesCS1D01G449400	chr2D	93.036	1321	25	12	1930	3194	537297839	537299148	0.000000e+00	1868
6	TraesCS1D01G449400	chr2D	96.292	971	21	5	2226	3194	587157898	587158855	0.000000e+00	1580
7	TraesCS1D01G449400	chr2D	92.218	1118	38	13	2115	3194	7874567	7875673	0.000000e+00	1537
8	TraesCS1D01G449400	chr2D	94.603	945	21	7	2268	3194	11054450	11055382	0.000000e+00	1435
9	TraesCS1D01G449400	chr2D	92.989	271	14	3	1931	2198	486489942	486490210	1.070000e-104	390
10	TraesCS1D01G449400	chr2D	95.851	241	9	1	2955	3194	621004831	621005071	3.860000e-104	388
11	TraesCS1D01G449400	chr2D	91.515	165	12	2	3030	3194	31852019	31852181	3.210000e-55	226
12	TraesCS1D01G449400	chr1A	83.689	1919	301	9	1	1915	589638472	589636562	0.000000e+00	1799
13	TraesCS1D01G449400	chr1A	82.461	1910	310	20	1	1902	589447184	589445292	0.000000e+00	1648
14	TraesCS1D01G449400	chr1A	84.091	1716	241	22	114	1811	589500513	589498812	0.000000e+00	1628
15	TraesCS1D01G449400	chr1A	81.771	1909	322	19	1	1902	589478851	589476962	0.000000e+00	1574
16	TraesCS1D01G449400	chr1A	82.512	1704	261	22	1	1695	589454185	589452510	0.000000e+00	1461
17	TraesCS1D01G449400	chr1B	83.722	1800	277	13	112	1902	683583314	683581522	0.000000e+00	1687
18	TraesCS1D01G449400	chr4D	96.995	965	24	3	2231	3194	505825226	505824266	0.000000e+00	1616
19	TraesCS1D01G449400	chr4D	96.274	832	24	3	2229	3060	1842326	1841502	0.000000e+00	1358
20	TraesCS1D01G449400	chr7D	94.654	954	19	7	2249	3194	529691501	529692430	0.000000e+00	1450
21	TraesCS1D01G449400	chr7D	96.353	850	22	8	2223	3070	592575551	592574709	0.000000e+00	1389
22	TraesCS1D01G449400	chr7D	93.943	875	24	5	2339	3194	622253968	622254832	0.000000e+00	1295
23	TraesCS1D01G449400	chr7D	94.298	719	14	8	2495	3194	511122299	511123009	0.000000e+00	1075
24	TraesCS1D01G449400	chr7D	92.982	741	15	6	2483	3194	1191778	1192510	0.000000e+00	1046
25	TraesCS1D01G449400	chr7D	93.818	275	10	2	1930	2198	529690890	529691163	1.070000e-109	407
26	TraesCS1D01G449400	chr7D	93.860	228	10	2	1926	2153	41257684	41257461	1.100000e-89	340
27	TraesCS1D01G449400	chr7D	92.083	240	15	3	1917	2153	593251804	593252042	5.110000e-88	335
28	TraesCS1D01G449400	chr7D	91.556	225	10	6	1930	2153	163212372	163212156	5.180000e-78	302
29	TraesCS1D01G449400	chr7D	96.970	132	3	1	3064	3194	15686352	15686221	1.490000e-53	220
30	TraesCS1D01G449400	chr7D	96.970	132	3	1	3064	3194	16668345	16668476	1.490000e-53	220
31	TraesCS1D01G449400	chr7D	96.970	132	3	1	3064	3194	17876406	17876275	1.490000e-53	220
32	TraesCS1D01G449400	chr7D	90.909	165	13	2	3030	3194	23262953	23262791	1.490000e-53	220
33	TraesCS1D01G449400	chr7D	96.970	132	3	1	3064	3194	55144478	55144347	1.490000e-53	220
34	TraesCS1D01G449400	chr7D	90.909	165	13	2	3030	3194	100749915	100750077	1.490000e-53	220
35	TraesCS1D01G449400	chr7D	90.303	165	14	2	3030	3194	19223032	19223194	6.940000e-52	215
36	TraesCS1D01G449400	chr7D	96.183	131	5	0	3064	3194	185772298	185772168	6.940000e-52	215
37	TraesCS1D01G449400	chr7D	90.909	165	7	7	3037	3194	546439812	546439975	6.940000e-52	215
38	TraesCS1D01G449400	chr7D	87.978	183	16	3	3017	3194	109539296	109539115	8.980000e-51	211
39	TraesCS1D01G449400	chr5D	91.597	1083	28	23	2104	3150	398642496	398643551	0.000000e+00	1437
40	TraesCS1D01G449400	chr5D	75.841	1813	392	34	116	1902	434474780	434476572	0.000000e+00	880
41	TraesCS1D01G449400	chr5D	95.089	224	6	1	1930	2153	560310903	560311121	6.560000e-92	348
42	TraesCS1D01G449400	chrUn	93.203	971	45	14	2112	3070	132052022	132052983	0.000000e+00	1408
43	TraesCS1D01G449400	chrUn	94.783	230	6	2	1925	2154	108306744	108306967	1.410000e-93	353
44	TraesCS1D01G449400	chr6D	96.411	836	25	3	2235	3070	36738775	36739605	0.000000e+00	1373
45	TraesCS1D01G449400	chr3B	91.816	892	54	10	2180	3060	768204742	768205625	0.000000e+00	1225
46	TraesCS1D01G449400	chr3B	88.506	87	5	4	2113	2197	28553970	28554053	2.030000e-17	100
47	TraesCS1D01G449400	chr3B	88.506	87	5	4	2113	2197	601004382	601004465	2.030000e-17	100
48	TraesCS1D01G449400	chr3B	88.506	87	5	4	2113	2197	645973691	645973774	2.030000e-17	100
49	TraesCS1D01G449400	chr5B	91.000	900	65	9	2180	3070	317946001	317946893	0.000000e+00	1199
50	TraesCS1D01G449400	chr3D	94.515	237	7	2	1930	2166	567706669	567706439	8.420000e-96	361
51	TraesCS1D01G449400	chr3D	90.830	229	11	6	1927	2153	614102881	614103101	6.700000e-77	298
52	TraesCS1D01G449400	chr2A	90.476	84	6	2	2115	2197	19371039	19371121	3.370000e-20	110
53	TraesCS1D01G449400	chr2A	90.476	84	7	1	2115	2197	19837966	19837883	3.370000e-20	110
54	TraesCS1D01G449400	chr2A	90.476	84	6	2	2115	2197	19838010	19837928	3.370000e-20	110

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS1D01G449400	chr1D	491662616	491665809	3193	True	5899.0	5899	100.0000	1	3194	1	chr1D.!!$R2	3193
1	TraesCS1D01G449400	chr1D	491694477	491696378	1901	True	1735.0	1735	83.1600	1	1915	1	chr1D.!!$R3	1914
2	TraesCS1D01G449400	chr1D	491637404	491639173	1769	True	1609.0	1609	83.1280	114	1891	1	chr1D.!!$R1	1777
3	TraesCS1D01G449400	chr1D	491686401	491688353	1952	True	865.0	1537	83.0655	1	1891	2	chr1D.!!$R4	1890
4	TraesCS1D01G449400	chr2D	537297839	537299148	1309	False	1868.0	1868	93.0360	1930	3194	1	chr2D.!!$F5	1264
5	TraesCS1D01G449400	chr2D	587157898	587158855	957	False	1580.0	1580	96.2920	2226	3194	1	chr2D.!!$F6	968
6	TraesCS1D01G449400	chr2D	7874567	7875673	1106	False	1537.0	1537	92.2180	2115	3194	1	chr2D.!!$F1	1079
7	TraesCS1D01G449400	chr2D	11054450	11055382	932	False	1435.0	1435	94.6030	2268	3194	1	chr2D.!!$F2	926
8	TraesCS1D01G449400	chr1A	589636562	589638472	1910	True	1799.0	1799	83.6890	1	1915	1	chr1A.!!$R5	1914
9	TraesCS1D01G449400	chr1A	589445292	589447184	1892	True	1648.0	1648	82.4610	1	1902	1	chr1A.!!$R1	1901
10	TraesCS1D01G449400	chr1A	589498812	589500513	1701	True	1628.0	1628	84.0910	114	1811	1	chr1A.!!$R4	1697
11	TraesCS1D01G449400	chr1A	589476962	589478851	1889	True	1574.0	1574	81.7710	1	1902	1	chr1A.!!$R3	1901
12	TraesCS1D01G449400	chr1A	589452510	589454185	1675	True	1461.0	1461	82.5120	1	1695	1	chr1A.!!$R2	1694
13	TraesCS1D01G449400	chr1B	683581522	683583314	1792	True	1687.0	1687	83.7220	112	1902	1	chr1B.!!$R1	1790
14	TraesCS1D01G449400	chr4D	505824266	505825226	960	True	1616.0	1616	96.9950	2231	3194	1	chr4D.!!$R2	963
15	TraesCS1D01G449400	chr4D	1841502	1842326	824	True	1358.0	1358	96.2740	2229	3060	1	chr4D.!!$R1	831
16	TraesCS1D01G449400	chr7D	592574709	592575551	842	True	1389.0	1389	96.3530	2223	3070	1	chr7D.!!$R9	847
17	TraesCS1D01G449400	chr7D	622253968	622254832	864	False	1295.0	1295	93.9430	2339	3194	1	chr7D.!!$F8	855
18	TraesCS1D01G449400	chr7D	511122299	511123009	710	False	1075.0	1075	94.2980	2495	3194	1	chr7D.!!$F5	699
19	TraesCS1D01G449400	chr7D	1191778	1192510	732	False	1046.0	1046	92.9820	2483	3194	1	chr7D.!!$F1	711
20	TraesCS1D01G449400	chr7D	529690890	529692430	1540	False	928.5	1450	94.2360	1930	3194	2	chr7D.!!$F9	1264
21	TraesCS1D01G449400	chr5D	398642496	398643551	1055	False	1437.0	1437	91.5970	2104	3150	1	chr5D.!!$F1	1046
22	TraesCS1D01G449400	chr5D	434474780	434476572	1792	False	880.0	880	75.8410	116	1902	1	chr5D.!!$F2	1786
23	TraesCS1D01G449400	chrUn	132052022	132052983	961	False	1408.0	1408	93.2030	2112	3070	1	chrUn.!!$F2	958
24	TraesCS1D01G449400	chr6D	36738775	36739605	830	False	1373.0	1373	96.4110	2235	3070	1	chr6D.!!$F1	835
25	TraesCS1D01G449400	chr3B	768204742	768205625	883	False	1225.0	1225	91.8160	2180	3060	1	chr3B.!!$F4	880
26	TraesCS1D01G449400	chr5B	317946001	317946893	892	False	1199.0	1199	91.0000	2180	3070	1	chr5B.!!$F1	890

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
85	86	0.251634	TGTGGAGATTGGCGCACATA	59.748	50.0	10.83	0.0	0.00	2.29	F
1917	2084	0.030235	GGTTTGAGAACACCGGCAAC	59.970	55.0	0.00	0.0	37.51	4.17	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2020	2187	0.175073	GATAGTTGGTCGCGGGTCTT	59.825	55.0	6.13	0.0	0.00	3.01	R
2820	3401	6.039616	GCACTTGTTGTTTTCCTGACAATAA	58.960	36.0	0.00	0.0	39.03	1.40	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
21	22	4.002906	TGTGTCAACCCTTAGTAGCTTG	57.997	45.455	0.00	0.00	0.00	4.01
41	42	4.011966	TGAACATGCTTGATGTCAGTCT	57.988	40.909	6.60	0.00	45.12	3.24
81	82	2.046023	CCTGTGGAGATTGGCGCA	60.046	61.111	10.83	0.00	0.00	6.09
83	84	1.672030	CTGTGGAGATTGGCGCACA	60.672	57.895	10.83	1.22	0.00	4.57
85	86	0.251634	TGTGGAGATTGGCGCACATA	59.748	50.000	10.83	0.00	0.00	2.29
89	90	1.331756	GGAGATTGGCGCACATACAAG	59.668	52.381	10.83	0.00	0.00	3.16
201	346	2.356638	TGGAAACAACAGCTTGACTGGA	60.357	45.455	0.00	0.00	43.56	3.86
250	395	7.651808	TGGTTTGATGAATTTGAAGTCTCTTC	58.348	34.615	2.95	2.95	0.00	2.87
260	405	9.225436	GAATTTGAAGTCTCTTCACTTATCCTT	57.775	33.333	11.05	0.00	36.71	3.36
299	444	4.481368	TTATTGACTCGCATTGGGTACT	57.519	40.909	0.24	0.00	0.00	2.73
300	445	2.093306	TTGACTCGCATTGGGTACTG	57.907	50.000	0.24	0.00	0.00	2.74
345	490	4.335315	TCGTTATCATCTTGTCATTTGGGC	59.665	41.667	0.00	0.00	0.00	5.36
360	505	0.853586	TGGGCCCCCAGTTTCCTAAT	60.854	55.000	22.27	0.00	41.89	1.73
431	576	5.883583	AGCCTAGTTGGTAGGATCCCAGG	62.884	56.522	8.55	3.78	44.94	4.45
499	644	0.796927	GAACCAACTAAGTGGCGAGC	59.203	55.000	0.00	0.00	43.00	5.03
532	677	4.081752	GTCTGGAGTTCATGTCAGTGATCT	60.082	45.833	0.00	0.00	32.36	2.75
533	678	4.529769	TCTGGAGTTCATGTCAGTGATCTT	59.470	41.667	0.00	0.00	30.42	2.40
560	705	7.609146	TCTTTCAATGCAGTCAAATCTACTGAT	59.391	33.333	7.39	0.00	45.89	2.90
609	754	8.830580	AGAACAATTGAGTTATTGGACATATCG	58.169	33.333	13.59	0.00	39.33	2.92
636	781	5.784578	ACTCTTTAAATGGGTTTGTGTCC	57.215	39.130	0.00	0.00	0.00	4.02
678	826	4.880886	GCAGGTTGCAATTTTGTTTTCT	57.119	36.364	0.59	0.00	44.26	2.52
724	872	4.325204	CCATGTCAATTTGTCAAATGCGAG	59.675	41.667	11.54	3.40	0.00	5.03
754	902	6.349363	GCGGGTCTTAGATCTTTCAAACAATT	60.349	38.462	0.00	0.00	0.00	2.32
788	936	1.963515	ACTTCCTGATTGTGGCCAAAC	59.036	47.619	7.24	0.00	33.44	2.93
879	1027	3.056536	TGGAAATCACGACTCTTCTCCTG	60.057	47.826	0.00	0.00	0.00	3.86

Showing 1 to 25 of 79 entries

Previous1 2 3 4Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
8	9	3.878778	AGCATGTTCAAGCTACTAAGGG	58.121	45.455	0.62	0.00	39.78	3.95
12	13	5.491070	ACATCAAGCATGTTCAAGCTACTA	58.509	37.500	3.05	0.00	43.89	1.82
14	15	4.154737	TGACATCAAGCATGTTCAAGCTAC	59.845	41.667	3.05	0.00	46.53	3.58
21	22	3.999001	TGAGACTGACATCAAGCATGTTC	59.001	43.478	0.00	0.00	46.53	3.18
81	82	8.648693	AGGTCTAAGTAAGTCAAACTTGTATGT	58.351	33.333	2.65	0.00	39.11	2.29
83	84	9.490379	CAAGGTCTAAGTAAGTCAAACTTGTAT	57.510	33.333	2.65	0.00	39.11	2.29
85	86	6.766467	CCAAGGTCTAAGTAAGTCAAACTTGT	59.234	38.462	2.65	0.00	39.11	3.16
89	90	5.861727	TCCCAAGGTCTAAGTAAGTCAAAC	58.138	41.667	0.00	0.00	0.00	2.93
191	264	3.668447	TCTGAAATCACTCCAGTCAAGC	58.332	45.455	0.00	0.00	0.00	4.01
197	342	7.627298	AAATGATCTTCTGAAATCACTCCAG	57.373	36.000	13.58	0.00	34.88	3.86
201	346	7.313646	CAGCAAAATGATCTTCTGAAATCACT	58.686	34.615	13.58	4.85	34.88	3.41
207	352	6.040729	TCAAACCAGCAAAATGATCTTCTGAA	59.959	34.615	0.00	0.00	0.00	3.02
268	413	6.851222	ATGCGAGTCAATAATAACTTCCAG	57.149	37.500	0.00	0.00	0.00	3.86
299	444	3.888323	TGCTAAATCCAAGTTGAACAGCA	59.112	39.130	3.87	8.66	34.36	4.41
300	445	4.503741	TGCTAAATCCAAGTTGAACAGC	57.496	40.909	3.87	6.25	0.00	4.40
345	490	1.007118	AGCCAATTAGGAAACTGGGGG	59.993	52.381	0.00	0.00	43.88	5.40
360	505	2.665000	CTCTGCCCTCGAAGCCAA	59.335	61.111	4.76	0.00	0.00	4.52
409	554	1.294068	TGGGATCCTACCAACTAGGCT	59.706	52.381	12.58	0.00	42.03	4.58
431	576	5.358725	TCAGAAAAGGTAGTCCAAAACCAAC	59.641	40.000	0.00	0.00	38.30	3.77
499	644	5.186021	ACATGAACTCCAGACTAAGTGGTAG	59.814	44.000	0.00	0.00	36.37	3.18
507	652	4.407365	TCACTGACATGAACTCCAGACTA	58.593	43.478	0.00	0.00	0.00	2.59
509	654	3.667497	TCACTGACATGAACTCCAGAC	57.333	47.619	0.00	0.00	0.00	3.51
532	677	8.077991	CAGTAGATTTGACTGCATTGAAAGAAA	58.922	33.333	0.00	0.00	38.06	2.52
533	678	7.445096	TCAGTAGATTTGACTGCATTGAAAGAA	59.555	33.333	0.00	0.00	43.37	2.52
560	705	5.063017	TGGTAACTTGGGTATCAAACCAA	57.937	39.130	0.00	0.00	44.74	3.67

Showing 1 to 25 of 93 entries

Previous1 2 3 4Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.