Multiple sequence alignment - TraesCS1D01G437400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G437400 chr1D 100.000 3313 0 0 1 3313 484794493 484797805 0.000000e+00 6119.0
1 TraesCS1D01G437400 chr1D 93.266 995 46 9 1 989 484737430 484738409 0.000000e+00 1447.0
2 TraesCS1D01G437400 chr1D 85.344 771 71 12 247 989 484563363 484564119 0.000000e+00 760.0
3 TraesCS1D01G437400 chr1D 95.250 400 16 2 1 400 484869222 484869618 6.030000e-177 630.0
4 TraesCS1D01G437400 chr1D 93.636 330 12 4 71 400 466603454 466603774 4.970000e-133 484.0
5 TraesCS1D01G437400 chr1D 91.077 325 19 7 1 319 484562532 484562852 6.570000e-117 431.0
6 TraesCS1D01G437400 chr1D 96.396 222 8 0 2153 2374 484566150 484566371 1.880000e-97 366.0
7 TraesCS1D01G437400 chr1D 79.335 421 50 19 2268 2669 484871192 484871594 9.120000e-66 261.0
8 TraesCS1D01G437400 chr1B 93.139 2055 83 20 852 2882 646685715 646687735 0.000000e+00 2961.0
9 TraesCS1D01G437400 chr1B 94.500 1509 58 9 1 1503 674892584 674894073 0.000000e+00 2303.0
10 TraesCS1D01G437400 chr1B 93.046 1510 42 19 1 1503 675223277 675221824 0.000000e+00 2148.0
11 TraesCS1D01G437400 chr1B 91.690 1408 44 18 1502 2901 674894187 674895529 0.000000e+00 1884.0
12 TraesCS1D01G437400 chr1B 91.690 1408 44 18 1502 2901 675221710 675220368 0.000000e+00 1884.0
13 TraesCS1D01G437400 chr1B 94.808 443 16 1 414 856 646685159 646685594 0.000000e+00 684.0
14 TraesCS1D01G437400 chr1B 95.952 420 12 2 2899 3313 674895574 674895993 0.000000e+00 676.0
15 TraesCS1D01G437400 chr1B 95.952 420 12 2 2899 3313 675220323 675219904 0.000000e+00 676.0
16 TraesCS1D01G437400 chr1B 96.500 400 10 3 1 400 674818739 674819134 0.000000e+00 658.0
17 TraesCS1D01G437400 chr1B 94.527 402 17 3 1 400 674932646 674933044 1.690000e-172 616.0
18 TraesCS1D01G437400 chr1B 92.262 336 19 4 659 989 675228607 675228274 1.390000e-128 470.0
19 TraesCS1D01G437400 chr1B 92.409 303 18 2 2075 2372 674821008 674821310 8.500000e-116 427.0
20 TraesCS1D01G437400 chr1B 95.082 183 5 1 3135 3313 675218212 675218030 5.410000e-73 285.0
21 TraesCS1D01G437400 chr1B 93.631 157 9 1 3125 3280 675218684 675218528 1.990000e-57 233.0
22 TraesCS1D01G437400 chr1B 93.860 114 7 0 2268 2381 674934584 674934697 4.400000e-39 172.0
23 TraesCS1D01G437400 chr1B 97.872 94 2 0 2808 2901 675219292 675219199 2.650000e-36 163.0
24 TraesCS1D01G437400 chr1B 92.063 63 4 1 3025 3087 646687875 646687936 1.640000e-13 87.9
25 TraesCS1D01G437400 chr1A 96.399 1666 50 5 173 1837 581914336 581915992 0.000000e+00 2736.0
26 TraesCS1D01G437400 chr1A 92.864 995 52 9 1 989 581878478 581879459 0.000000e+00 1426.0
27 TraesCS1D01G437400 chr1A 98.483 725 11 0 2589 3313 581916682 581917406 0.000000e+00 1279.0
28 TraesCS1D01G437400 chr1A 98.011 704 9 2 1858 2560 581915983 581916682 0.000000e+00 1218.0
29 TraesCS1D01G437400 chr1A 95.103 776 29 2 508 1279 581957247 581958017 0.000000e+00 1214.0
30 TraesCS1D01G437400 chr1A 88.073 218 17 8 2281 2492 582218631 582218845 1.970000e-62 250.0
31 TraesCS1D01G437400 chr1A 85.714 203 26 3 901 1102 581958853 581959053 9.310000e-51 211.0
32 TraesCS1D01G437400 chr2A 87.368 190 20 4 3116 3303 3457059 3456872 7.200000e-52 215.0
33 TraesCS1D01G437400 chr4D 81.159 207 36 3 3100 3304 125783224 125783429 2.650000e-36 163.0
34 TraesCS1D01G437400 chr5D 81.159 207 31 7 3100 3303 410265174 410264973 3.420000e-35 159.0
35 TraesCS1D01G437400 chr5B 80.193 207 33 7 3100 3303 492110153 492109952 7.410000e-32 148.0
36 TraesCS1D01G437400 chr3A 86.957 69 9 0 2955 3023 93995809 93995877 9.860000e-11 78.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G437400 chr1D 484794493 484797805 3312 False 6119.000000 6119 100.000000 1 3313 1 chr1D.!!$F3 3312
1 TraesCS1D01G437400 chr1D 484737430 484738409 979 False 1447.000000 1447 93.266000 1 989 1 chr1D.!!$F2 988
2 TraesCS1D01G437400 chr1D 484562532 484566371 3839 False 519.000000 760 90.939000 1 2374 3 chr1D.!!$F4 2373
3 TraesCS1D01G437400 chr1D 484869222 484871594 2372 False 445.500000 630 87.292500 1 2669 2 chr1D.!!$F5 2668
4 TraesCS1D01G437400 chr1B 674892584 674895993 3409 False 1621.000000 2303 94.047333 1 3313 3 chr1B.!!$F3 3312
5 TraesCS1D01G437400 chr1B 646685159 646687936 2777 False 1244.300000 2961 93.336667 414 3087 3 chr1B.!!$F1 2673
6 TraesCS1D01G437400 chr1B 675218030 675223277 5247 True 898.166667 2148 94.545500 1 3313 6 chr1B.!!$R2 3312
7 TraesCS1D01G437400 chr1B 674818739 674821310 2571 False 542.500000 658 94.454500 1 2372 2 chr1B.!!$F2 2371
8 TraesCS1D01G437400 chr1B 674932646 674934697 2051 False 394.000000 616 94.193500 1 2381 2 chr1B.!!$F4 2380
9 TraesCS1D01G437400 chr1A 581914336 581917406 3070 False 1744.333333 2736 97.631000 173 3313 3 chr1A.!!$F3 3140
10 TraesCS1D01G437400 chr1A 581878478 581879459 981 False 1426.000000 1426 92.864000 1 989 1 chr1A.!!$F1 988
11 TraesCS1D01G437400 chr1A 581957247 581959053 1806 False 712.500000 1214 90.408500 508 1279 2 chr1A.!!$F4 771

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
567 1166 0.983467 TGCTGTAAGATGGGCTGTGA 59.017 50.0 0.0 0.0 34.07 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2336 4996 0.737219 GGTGACTTGCATCATGCTCC 59.263 55.0 11.84 0.51 45.31 4.7 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
193 196 4.170256 CCAACTGTTTTGTTTGTTAGCGT 58.830 39.130 0.00 0.00 0.00 5.07
275 867 6.785963 TGAACCCGTTATATTTATCTCTCCCT 59.214 38.462 0.00 0.00 0.00 4.20
407 999 2.154462 GTGAGTGCTTGCTAATGGTGT 58.846 47.619 0.00 0.00 0.00 4.16
425 1017 1.061421 TGTGACGACTGTTTTGTTCGC 59.939 47.619 0.00 0.00 0.00 4.70
567 1166 0.983467 TGCTGTAAGATGGGCTGTGA 59.017 50.000 0.00 0.00 34.07 3.58
1829 4408 2.804856 GCAACAAGGTGCACGGTT 59.195 55.556 11.45 12.14 44.29 4.44
1899 4480 8.757877 AGACTAGACATGCTTATTCTTTCTCTT 58.242 33.333 0.00 0.00 0.00 2.85
2336 4996 2.427453 ACAGTAGGCTTGAGACATACCG 59.573 50.000 0.00 0.00 0.00 4.02
2381 5051 6.681729 ACTTACTTACCATCCTCAAGACAA 57.318 37.500 0.00 0.00 0.00 3.18
2382 5052 7.259088 ACTTACTTACCATCCTCAAGACAAT 57.741 36.000 0.00 0.00 0.00 2.71
2383 5053 7.690256 ACTTACTTACCATCCTCAAGACAATT 58.310 34.615 0.00 0.00 0.00 2.32
2384 5054 7.607991 ACTTACTTACCATCCTCAAGACAATTG 59.392 37.037 3.24 3.24 0.00 2.32
2385 5055 4.702131 ACTTACCATCCTCAAGACAATTGC 59.298 41.667 5.05 0.00 0.00 3.56
2386 5056 2.450476 ACCATCCTCAAGACAATTGCC 58.550 47.619 5.05 0.00 0.00 4.52
2387 5057 2.225091 ACCATCCTCAAGACAATTGCCA 60.225 45.455 5.05 0.00 0.00 4.92
2388 5058 2.165030 CCATCCTCAAGACAATTGCCAC 59.835 50.000 5.05 0.00 0.00 5.01
2389 5059 2.957402 TCCTCAAGACAATTGCCACT 57.043 45.000 5.05 0.00 0.00 4.00
2390 5060 2.783135 TCCTCAAGACAATTGCCACTC 58.217 47.619 5.05 0.00 0.00 3.51
2391 5061 2.106338 TCCTCAAGACAATTGCCACTCA 59.894 45.455 5.05 0.00 0.00 3.41
2585 5302 2.028883 GCGTAAGAATAGTTGCCGTCAC 59.971 50.000 0.00 0.00 43.02 3.67
3138 5951 1.686115 GGCAATGGGTTGAGGCATAGT 60.686 52.381 0.00 0.00 37.53 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
257 849 9.213799 CTCAGCAAAGGGAGAGATAAATATAAC 57.786 37.037 0.00 0.00 32.87 1.89
275 867 6.671190 CAACTGAATATTGACACTCAGCAAA 58.329 36.000 0.00 0.00 39.13 3.68
407 999 1.647346 AGCGAACAAAACAGTCGTCA 58.353 45.000 0.00 0.00 0.00 4.35
567 1166 3.524095 TTCCAACAGAACATCCCACAT 57.476 42.857 0.00 0.00 0.00 3.21
910 1666 5.061853 CAGATGGTACTTGATTGGGAGATG 58.938 45.833 0.00 0.00 0.00 2.90
1829 4408 5.209818 ACACGAATACACAAGAAGGAAGA 57.790 39.130 0.00 0.00 0.00 2.87
2336 4996 0.737219 GGTGACTTGCATCATGCTCC 59.263 55.000 11.84 0.51 45.31 4.70
2381 5051 2.306805 TGAACAGGAGATGAGTGGCAAT 59.693 45.455 0.00 0.00 0.00 3.56
2382 5052 1.699083 TGAACAGGAGATGAGTGGCAA 59.301 47.619 0.00 0.00 0.00 4.52
2383 5053 1.277273 CTGAACAGGAGATGAGTGGCA 59.723 52.381 0.00 0.00 0.00 4.92
2384 5054 1.552337 TCTGAACAGGAGATGAGTGGC 59.448 52.381 1.93 0.00 0.00 5.01
2385 5055 5.539574 AGATATCTGAACAGGAGATGAGTGG 59.460 44.000 3.89 0.00 32.32 4.00
2386 5056 6.294675 GGAGATATCTGAACAGGAGATGAGTG 60.295 46.154 10.74 0.00 32.32 3.51
2387 5057 5.774690 GGAGATATCTGAACAGGAGATGAGT 59.225 44.000 10.74 0.00 32.32 3.41
2388 5058 5.185635 GGGAGATATCTGAACAGGAGATGAG 59.814 48.000 10.74 0.00 32.32 2.90
2389 5059 5.083122 GGGAGATATCTGAACAGGAGATGA 58.917 45.833 10.74 0.00 32.32 2.92
2390 5060 4.837298 TGGGAGATATCTGAACAGGAGATG 59.163 45.833 10.74 0.00 32.32 2.90
2391 5061 4.837860 GTGGGAGATATCTGAACAGGAGAT 59.162 45.833 10.74 0.00 34.47 2.75
3138 5951 3.417101 ACAAATACATCGGGTTGCAAGA 58.583 40.909 0.00 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.