Multiple sequence alignment - TraesCS1D01G436400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G436400 chr1D 100.000 2201 0 0 1 2201 484250498 484252698 0.000000e+00 4065.0
1 TraesCS1D01G436400 chr1D 78.418 1214 220 31 592 1780 484114125 484115321 0.000000e+00 752.0
2 TraesCS1D01G436400 chr1D 81.884 138 22 3 173 308 484112641 484112777 1.790000e-21 113.0
3 TraesCS1D01G436400 chr1A 93.132 2053 104 17 1 2043 581432722 581434747 0.000000e+00 2976.0
4 TraesCS1D01G436400 chr1A 78.831 1129 210 24 592 1707 581255796 581256908 0.000000e+00 734.0
5 TraesCS1D01G436400 chr1A 80.170 943 156 24 616 1549 581205810 581206730 0.000000e+00 676.0
6 TraesCS1D01G436400 chr1A 80.103 779 122 24 616 1386 581110083 581110836 1.150000e-152 549.0
7 TraesCS1D01G436400 chr1A 83.212 137 22 1 173 308 581254344 581254480 8.250000e-25 124.0
8 TraesCS1D01G436400 chr1B 93.398 1348 78 7 856 2199 674494862 674496202 0.000000e+00 1986.0
9 TraesCS1D01G436400 chr1B 95.471 817 35 2 1 817 674494052 674494866 0.000000e+00 1303.0
10 TraesCS1D01G436400 chr1B 81.998 811 126 14 737 1543 674053614 674054408 0.000000e+00 671.0
11 TraesCS1D01G436400 chr1B 80.727 825 143 15 725 1543 674065552 674066366 1.430000e-176 628.0
12 TraesCS1D01G436400 chr5A 75.775 677 133 21 861 1524 643922179 643922837 1.640000e-81 313.0
13 TraesCS1D01G436400 chr5A 86.047 86 10 2 28 112 827888 827972 8.370000e-15 91.6
14 TraesCS1D01G436400 chr5B 76.505 515 96 21 1014 1524 648287359 648287852 7.800000e-65 257.0
15 TraesCS1D01G436400 chr7D 89.157 83 8 1 24 106 596094383 596094302 3.870000e-18 102.0
16 TraesCS1D01G436400 chr7B 85.542 83 11 1 24 106 674197520 674197439 3.890000e-13 86.1
17 TraesCS1D01G436400 chr7B 86.538 52 5 2 114 163 679309977 679310028 3.050000e-04 56.5
18 TraesCS1D01G436400 chr3D 92.593 54 2 2 114 165 292114982 292115035 2.340000e-10 76.8
19 TraesCS1D01G436400 chr2D 90.741 54 3 2 114 165 554121420 554121367 1.090000e-08 71.3
20 TraesCS1D01G436400 chr2D 100.000 28 0 0 14 41 617542828 617542801 4.000000e-03 52.8
21 TraesCS1D01G436400 chr2B 85.455 55 6 2 114 166 373744279 373744225 3.050000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G436400 chr1D 484250498 484252698 2200 False 4065.0 4065 100.0000 1 2201 1 chr1D.!!$F1 2200
1 TraesCS1D01G436400 chr1D 484112641 484115321 2680 False 432.5 752 80.1510 173 1780 2 chr1D.!!$F2 1607
2 TraesCS1D01G436400 chr1A 581432722 581434747 2025 False 2976.0 2976 93.1320 1 2043 1 chr1A.!!$F3 2042
3 TraesCS1D01G436400 chr1A 581205810 581206730 920 False 676.0 676 80.1700 616 1549 1 chr1A.!!$F2 933
4 TraesCS1D01G436400 chr1A 581110083 581110836 753 False 549.0 549 80.1030 616 1386 1 chr1A.!!$F1 770
5 TraesCS1D01G436400 chr1A 581254344 581256908 2564 False 429.0 734 81.0215 173 1707 2 chr1A.!!$F4 1534
6 TraesCS1D01G436400 chr1B 674494052 674496202 2150 False 1644.5 1986 94.4345 1 2199 2 chr1B.!!$F3 2198
7 TraesCS1D01G436400 chr1B 674053614 674054408 794 False 671.0 671 81.9980 737 1543 1 chr1B.!!$F1 806
8 TraesCS1D01G436400 chr1B 674065552 674066366 814 False 628.0 628 80.7270 725 1543 1 chr1B.!!$F2 818
9 TraesCS1D01G436400 chr5A 643922179 643922837 658 False 313.0 313 75.7750 861 1524 1 chr5A.!!$F2 663

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
354 356 0.340908 GTAGAGTTACCCCCTCCCCA 59.659 60.0 0.0 0.0 0.0 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2028 3287 3.884693 ACACTTGTCTTGCATGACATGAA 59.115 39.13 35.29 22.38 45.03 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 63 7.231467 GTGGGTATACCTTATGGTCAAATGAT 58.769 38.462 21.25 0.00 44.78 2.45
168 169 7.962964 AGAAACATTTGAGACGTATCAGAAA 57.037 32.000 13.25 6.38 0.00 2.52
354 356 0.340908 GTAGAGTTACCCCCTCCCCA 59.659 60.000 0.00 0.00 0.00 4.96
1298 2538 8.783093 TCCACATATATATTTTGTGTTGCTAGC 58.217 33.333 8.10 8.10 39.23 3.42
1299 2539 8.786898 CCACATATATATTTTGTGTTGCTAGCT 58.213 33.333 17.23 0.00 39.23 3.32
1352 2593 5.710409 TTTCCTAATAAAGTGGGAGGAGG 57.290 43.478 0.00 0.00 37.60 4.30
1386 2627 4.842292 TTGCAATGTGCCGCAAAA 57.158 44.444 0.00 0.00 44.71 2.44
1387 2628 3.302375 TTGCAATGTGCCGCAAAAT 57.698 42.105 0.00 0.00 44.71 1.82
1496 2741 7.353414 TGGACTATTTGTTGTTGATTCCAAA 57.647 32.000 0.00 0.00 33.49 3.28
1516 2761 8.450578 TCCAAAGTATTGCTAAACATATCAGG 57.549 34.615 0.00 0.00 35.10 3.86
1701 2947 0.397941 TGCCAAAGACTCCTCCACAG 59.602 55.000 0.00 0.00 0.00 3.66
1748 3004 6.491745 TGTTGTGACCCTTGCTAATGAAATTA 59.508 34.615 0.00 0.00 37.87 1.40
1799 3055 9.579932 AAAGAGAACTAATTGTCCAGAAAAGAT 57.420 29.630 0.00 0.00 0.00 2.40
2028 3287 8.976353 TGTGTGGGCATTATGATAAAATAAGTT 58.024 29.630 0.00 0.00 0.00 2.66
2063 3322 5.304686 AGACAAGTGTGGTTTGGATAGAA 57.695 39.130 0.00 0.00 0.00 2.10
2075 3334 8.314021 GTGGTTTGGATAGAATCAAAGGAAAAT 58.686 33.333 0.00 0.00 34.11 1.82
2199 3458 9.866655 AAATAAATAGACAGGCTATCCAATTCA 57.133 29.630 0.00 0.00 38.88 2.57
2200 3459 9.866655 AATAAATAGACAGGCTATCCAATTCAA 57.133 29.630 0.00 0.00 38.88 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2 3 4.624024 GCATGTACAAGCTAAACGTAGACA 59.376 41.667 15.56 0.00 0.00 3.41
11 12 4.821260 CCATATGTGGCATGTACAAGCTAA 59.179 41.667 21.24 8.69 39.01 3.09
17 18 2.777114 ACCTCCATATGTGGCATGTACA 59.223 45.455 3.06 0.00 45.63 2.90
147 148 8.783093 TCAAATTTCTGATACGTCTCAAATGTT 58.217 29.630 5.09 0.00 0.00 2.71
250 252 5.056480 TGTCTGGTTCAAAGTACATCACTG 58.944 41.667 0.00 0.00 37.63 3.66
354 356 9.229784 CGTATTCAGATTTAGTACACAATACGT 57.770 33.333 11.03 0.00 41.07 3.57
719 1057 5.860182 CCTAGACATGTTGACTGCATTTTTG 59.140 40.000 0.00 0.00 0.00 2.44
967 1334 1.398390 CAAAGAGCGGTAGAATGCACC 59.602 52.381 0.00 0.00 0.00 5.01
1214 1582 7.834881 TTCCTAGCTTATTTATCGAAGGAGA 57.165 36.000 0.00 0.00 33.64 3.71
1333 2573 6.765355 ATAACCTCCTCCCACTTTATTAGG 57.235 41.667 0.00 0.00 0.00 2.69
1352 2593 8.859156 CACATTGCAAACAACATAGGTAATAAC 58.141 33.333 1.71 0.00 38.99 1.89
1496 2741 7.937394 GGGTTACCTGATATGTTTAGCAATACT 59.063 37.037 0.00 0.00 0.00 2.12
1748 3004 8.556213 TTATTTTACAAGCTCGGTTGAGTAAT 57.444 30.769 14.94 11.73 44.48 1.89
2028 3287 3.884693 ACACTTGTCTTGCATGACATGAA 59.115 39.130 35.29 22.38 45.03 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.