Multiple sequence alignment - TraesCS1D01G399200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G399200 chr1D 100.000 2504 0 0 1 2504 465902346 465904849 0.000000e+00 4625
1 TraesCS1D01G399200 chr1B 96.187 2518 62 8 1 2504 642700685 642703182 0.000000e+00 4087
2 TraesCS1D01G399200 chr1B 92.469 810 48 7 1702 2504 512455507 512456310 0.000000e+00 1146
3 TraesCS1D01G399200 chr1B 88.976 889 79 8 1572 2448 664430132 664431013 0.000000e+00 1081
4 TraesCS1D01G399200 chr3B 92.655 1593 72 15 1 1561 173007040 173008619 0.000000e+00 2252
5 TraesCS1D01G399200 chr3B 94.554 863 37 6 1 860 172171304 172170449 0.000000e+00 1325
6 TraesCS1D01G399200 chr3B 94.438 845 37 6 1 842 172052944 172052107 0.000000e+00 1291
7 TraesCS1D01G399200 chr3B 92.588 796 49 5 1 795 146981672 146982458 0.000000e+00 1134
8 TraesCS1D01G399200 chr3D 92.487 1584 81 9 1 1557 121341181 121342753 0.000000e+00 2231
9 TraesCS1D01G399200 chr3D 91.628 860 57 6 1 860 120143273 120142429 0.000000e+00 1175
10 TraesCS1D01G399200 chr3D 90.117 769 63 6 1574 2331 460533030 460532264 0.000000e+00 987
11 TraesCS1D01G399200 chr3A 92.522 1578 76 16 1 1551 127858137 127859699 0.000000e+00 2222
12 TraesCS1D01G399200 chr3A 90.625 96 9 0 2409 2504 182619104 182619199 7.270000e-26 128
13 TraesCS1D01G399200 chr5B 94.241 955 43 3 1561 2504 452228991 452228038 0.000000e+00 1448
14 TraesCS1D01G399200 chr5B 90.360 861 63 12 1 860 507802239 507803080 0.000000e+00 1112
15 TraesCS1D01G399200 chr5A 90.919 947 71 6 1573 2504 671867215 671868161 0.000000e+00 1258
16 TraesCS1D01G399200 chr7B 90.046 874 75 6 1574 2437 253591442 253592313 0.000000e+00 1122
17 TraesCS1D01G399200 chr6D 90.102 879 56 13 1 860 452127209 452128075 0.000000e+00 1112
18 TraesCS1D01G399200 chr5D 91.202 807 58 7 1706 2504 439393661 439394462 0.000000e+00 1085
19 TraesCS1D01G399200 chr5D 89.754 771 66 6 1572 2331 492288181 492287413 0.000000e+00 974
20 TraesCS1D01G399200 chrUn 75.210 476 92 22 2039 2498 137644951 137644486 4.220000e-48 202


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G399200 chr1D 465902346 465904849 2503 False 4625 4625 100.000 1 2504 1 chr1D.!!$F1 2503
1 TraesCS1D01G399200 chr1B 642700685 642703182 2497 False 4087 4087 96.187 1 2504 1 chr1B.!!$F2 2503
2 TraesCS1D01G399200 chr1B 512455507 512456310 803 False 1146 1146 92.469 1702 2504 1 chr1B.!!$F1 802
3 TraesCS1D01G399200 chr1B 664430132 664431013 881 False 1081 1081 88.976 1572 2448 1 chr1B.!!$F3 876
4 TraesCS1D01G399200 chr3B 173007040 173008619 1579 False 2252 2252 92.655 1 1561 1 chr3B.!!$F2 1560
5 TraesCS1D01G399200 chr3B 172170449 172171304 855 True 1325 1325 94.554 1 860 1 chr3B.!!$R2 859
6 TraesCS1D01G399200 chr3B 172052107 172052944 837 True 1291 1291 94.438 1 842 1 chr3B.!!$R1 841
7 TraesCS1D01G399200 chr3B 146981672 146982458 786 False 1134 1134 92.588 1 795 1 chr3B.!!$F1 794
8 TraesCS1D01G399200 chr3D 121341181 121342753 1572 False 2231 2231 92.487 1 1557 1 chr3D.!!$F1 1556
9 TraesCS1D01G399200 chr3D 120142429 120143273 844 True 1175 1175 91.628 1 860 1 chr3D.!!$R1 859
10 TraesCS1D01G399200 chr3D 460532264 460533030 766 True 987 987 90.117 1574 2331 1 chr3D.!!$R2 757
11 TraesCS1D01G399200 chr3A 127858137 127859699 1562 False 2222 2222 92.522 1 1551 1 chr3A.!!$F1 1550
12 TraesCS1D01G399200 chr5B 452228038 452228991 953 True 1448 1448 94.241 1561 2504 1 chr5B.!!$R1 943
13 TraesCS1D01G399200 chr5B 507802239 507803080 841 False 1112 1112 90.360 1 860 1 chr5B.!!$F1 859
14 TraesCS1D01G399200 chr5A 671867215 671868161 946 False 1258 1258 90.919 1573 2504 1 chr5A.!!$F1 931
15 TraesCS1D01G399200 chr7B 253591442 253592313 871 False 1122 1122 90.046 1574 2437 1 chr7B.!!$F1 863
16 TraesCS1D01G399200 chr6D 452127209 452128075 866 False 1112 1112 90.102 1 860 1 chr6D.!!$F1 859
17 TraesCS1D01G399200 chr5D 439393661 439394462 801 False 1085 1085 91.202 1706 2504 1 chr5D.!!$F1 798
18 TraesCS1D01G399200 chr5D 492287413 492288181 768 True 974 974 89.754 1572 2331 1 chr5D.!!$R1 759

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
554 555 2.251642 GCGACGTTTGCCCTTGAGT 61.252 57.895 2.57 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2187 2302 1.60648 CGCATCATGCTAGGAACCGAT 60.606 52.381 8.3 0.0 42.25 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
333 334 2.432300 TAGGGCTTGAGGTAGGCGC 61.432 63.158 0.00 0.0 43.45 6.53
554 555 2.251642 GCGACGTTTGCCCTTGAGT 61.252 57.895 2.57 0.0 0.00 3.41
1520 1606 0.888619 TGAACGATTCGTCCTGAGCT 59.111 50.000 12.80 0.0 39.99 4.09
1891 1994 7.239763 TGCATATTAATAGATCGGTGAGGAA 57.760 36.000 1.02 0.0 0.00 3.36
2037 2150 8.563123 AGATGATATTTAGATACGACTTCCGA 57.437 34.615 0.00 0.0 41.76 4.55
2061 2174 4.081697 TGCTGTCGATGGTTCATCTAAAGA 60.082 41.667 6.37 0.0 38.59 2.52
2187 2302 3.512329 TGGTTGTTACGATGGCTCTCTTA 59.488 43.478 0.00 0.0 0.00 2.10
2252 2367 2.359230 AAGCCTGACCTTGAGCGC 60.359 61.111 0.00 0.0 0.00 5.92
2437 2552 4.657814 ATGGTAGGAAGCAAAAGAAGGA 57.342 40.909 0.00 0.0 36.53 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
554 555 2.494445 CAGGGCGACATCGTGCTA 59.506 61.111 2.85 0.00 42.22 3.49
1592 1683 7.165485 TCACTCTTAAAATACTTGGCTTGCTA 58.835 34.615 0.00 0.00 0.00 3.49
1798 1899 4.594123 TCAAACATCGAGTACTCACCAA 57.406 40.909 22.37 5.32 0.00 3.67
1884 1987 2.919228 ACCTCTGTTGTTGTTCCTCAC 58.081 47.619 0.00 0.00 0.00 3.51
2037 2150 2.996249 AGATGAACCATCGACAGCAT 57.004 45.000 0.00 0.00 44.67 3.79
2061 2174 3.021695 CCTGGTTCTCATCATGCATTGT 58.978 45.455 0.00 0.00 0.00 2.71
2187 2302 1.606480 CGCATCATGCTAGGAACCGAT 60.606 52.381 8.30 0.00 42.25 4.18
2252 2367 8.859236 AGATTACATTGACCCAGATTATGATG 57.141 34.615 0.00 0.00 0.00 3.07
2420 2535 4.012374 CTGCATCCTTCTTTTGCTTCCTA 58.988 43.478 0.00 0.00 37.28 2.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.