Multiple sequence alignment - TraesCS1D01G399100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G399100 chr1D 100.000 4370 0 0 1 4370 465904040 465899671 0.000000e+00 8070.0
1 TraesCS1D01G399100 chr1D 90.835 862 77 2 2530 3390 430228211 430229071 0.000000e+00 1153.0
2 TraesCS1D01G399100 chr1B 97.398 4382 77 9 1 4370 642702366 642698010 0.000000e+00 7426.0
3 TraesCS1D01G399100 chr1B 84.416 462 42 19 3447 3879 621606171 621605711 1.120000e-115 427.0
4 TraesCS1D01G399100 chr3D 90.652 4311 287 35 139 4370 121342753 121338480 0.000000e+00 5622.0
5 TraesCS1D01G399100 chr3D 92.509 2603 169 12 836 3436 120142429 120145007 0.000000e+00 3703.0
6 TraesCS1D01G399100 chr3A 90.185 4218 296 57 145 4272 127859699 127855510 0.000000e+00 5387.0
7 TraesCS1D01G399100 chr3A 80.932 472 36 24 3462 3879 735483158 735482687 1.520000e-84 324.0
8 TraesCS1D01G399100 chr3A 80.297 472 39 21 3462 3879 735448339 735448810 1.530000e-79 307.0
9 TraesCS1D01G399100 chr3B 91.380 3608 230 30 135 3679 173008619 173005030 0.000000e+00 4865.0
10 TraesCS1D01G399100 chr3B 93.882 2599 142 10 836 3428 172170449 172173036 0.000000e+00 3903.0
11 TraesCS1D01G399100 chr3B 93.685 2581 147 9 854 3428 172052107 172054677 0.000000e+00 3849.0
12 TraesCS1D01G399100 chr3B 93.083 2530 160 8 901 3427 146982458 146979941 0.000000e+00 3688.0
13 TraesCS1D01G399100 chr3B 91.064 705 36 5 3692 4370 173004933 173004230 0.000000e+00 928.0
14 TraesCS1D01G399100 chr3B 81.959 582 48 27 3335 3863 172054954 172055531 1.440000e-119 440.0
15 TraesCS1D01G399100 chr3B 84.267 464 41 21 3447 3879 18022507 18022045 1.450000e-114 424.0
16 TraesCS1D01G399100 chr6D 91.881 2685 179 19 836 3496 452128075 452125406 0.000000e+00 3714.0
17 TraesCS1D01G399100 chr5B 90.612 2695 199 28 836 3524 507803080 507800434 0.000000e+00 3526.0
18 TraesCS1D01G399100 chr5B 92.143 140 6 1 1 135 452228852 452228991 4.460000e-45 193.0
19 TraesCS1D01G399100 chrUn 85.281 462 38 19 3447 3879 219069292 219068832 2.400000e-122 449.0
20 TraesCS1D01G399100 chr7B 85.065 462 39 19 3447 3879 733237148 733236688 1.120000e-120 444.0
21 TraesCS1D01G399100 chr2D 91.129 124 11 0 1 124 459840414 459840291 7.520000e-38 169.0
22 TraesCS1D01G399100 chr6B 89.231 65 7 0 3969 4033 490499887 490499951 1.010000e-11 82.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G399100 chr1D 465899671 465904040 4369 True 8070.0 8070 100.000 1 4370 1 chr1D.!!$R1 4369
1 TraesCS1D01G399100 chr1D 430228211 430229071 860 False 1153.0 1153 90.835 2530 3390 1 chr1D.!!$F1 860
2 TraesCS1D01G399100 chr1B 642698010 642702366 4356 True 7426.0 7426 97.398 1 4370 1 chr1B.!!$R2 4369
3 TraesCS1D01G399100 chr3D 121338480 121342753 4273 True 5622.0 5622 90.652 139 4370 1 chr3D.!!$R1 4231
4 TraesCS1D01G399100 chr3D 120142429 120145007 2578 False 3703.0 3703 92.509 836 3436 1 chr3D.!!$F1 2600
5 TraesCS1D01G399100 chr3A 127855510 127859699 4189 True 5387.0 5387 90.185 145 4272 1 chr3A.!!$R1 4127
6 TraesCS1D01G399100 chr3B 172170449 172173036 2587 False 3903.0 3903 93.882 836 3428 1 chr3B.!!$F1 2592
7 TraesCS1D01G399100 chr3B 146979941 146982458 2517 True 3688.0 3688 93.083 901 3427 1 chr3B.!!$R2 2526
8 TraesCS1D01G399100 chr3B 173004230 173008619 4389 True 2896.5 4865 91.222 135 4370 2 chr3B.!!$R3 4235
9 TraesCS1D01G399100 chr3B 172052107 172055531 3424 False 2144.5 3849 87.822 854 3863 2 chr3B.!!$F2 3009
10 TraesCS1D01G399100 chr6D 452125406 452128075 2669 True 3714.0 3714 91.881 836 3496 1 chr6D.!!$R1 2660
11 TraesCS1D01G399100 chr5B 507800434 507803080 2646 True 3526.0 3526 90.612 836 3524 1 chr5B.!!$R1 2688

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
103 106 7.119262 TCACTCTTAAAATACTTGGCTTGCTAC 59.881 37.037 0.00 0.0 0.00 3.58 F
1140 1221 2.494445 CAGGGCGACATCGTGCTA 59.506 61.111 2.85 0.0 42.22 3.49 F
2126 2207 0.742281 CTCCGCATCCACACCAAGAG 60.742 60.000 0.00 0.0 0.00 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1854 1935 1.413118 TGAAGATGATAGAGGGCGCA 58.587 50.0 10.83 0.00 0.00 6.09 R
2767 2849 0.756294 TCGGTGAGAAGCTGGTTCAA 59.244 50.0 20.36 6.63 37.67 2.69 R
4108 4762 2.432146 TGGCTAAGCTATCAGTCAGTGG 59.568 50.0 0.00 0.00 0.00 4.00 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 80 8.538701 AGATCTGTGTCTGAGTTTTTCTATCAT 58.461 33.333 0.00 0.00 0.00 2.45
81 84 7.445121 TGTGTCTGAGTTTTTCTATCATCACT 58.555 34.615 0.00 0.00 33.22 3.41
102 105 7.165485 TCACTCTTAAAATACTTGGCTTGCTA 58.835 34.615 0.00 0.00 0.00 3.49
103 106 7.119262 TCACTCTTAAAATACTTGGCTTGCTAC 59.881 37.037 0.00 0.00 0.00 3.58
1140 1221 2.494445 CAGGGCGACATCGTGCTA 59.506 61.111 2.85 0.00 42.22 3.49
1776 1857 4.386873 GGGGCCTTCTTCTTCCTTATCAAT 60.387 45.833 0.84 0.00 0.00 2.57
1854 1935 2.151502 TCGAGGAGGCTGAGAAGAAT 57.848 50.000 0.00 0.00 0.00 2.40
2126 2207 0.742281 CTCCGCATCCACACCAAGAG 60.742 60.000 0.00 0.00 0.00 2.85
2514 2596 1.375326 GTCCAAGGGCGTCCTCTTT 59.625 57.895 10.20 0.00 44.07 2.52
2694 2776 2.251642 GCCGTGCGTCCTGTTCTTT 61.252 57.895 0.00 0.00 0.00 2.52
2790 2872 1.270907 ACCAGCTTCTCACCGAGATT 58.729 50.000 0.00 0.00 38.56 2.40
2913 2995 2.196742 TCTACATCCCCTTGCCAGAT 57.803 50.000 0.00 0.00 0.00 2.90
3007 3089 4.196778 TGGCAAGGTTCACCGCCA 62.197 61.111 12.25 12.25 45.97 5.69
3275 3357 1.003051 AGTCTAGGGGGTTCGGCAT 59.997 57.895 0.00 0.00 0.00 4.40
3354 3442 2.224572 GGCAGCTGATGAGGATGAAGAT 60.225 50.000 20.43 0.00 0.00 2.40
4108 4762 7.503549 AGACTACTAAGAACTAGACTCTAGCC 58.496 42.308 12.36 5.69 0.00 3.93
4234 4894 9.701098 AAAAGTGTCGAATAACTGAACTATGTA 57.299 29.630 0.00 0.00 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 80 6.003950 AGCAAGCCAAGTATTTTAAGAGTGA 58.996 36.000 0.00 0.00 0.00 3.41
81 84 5.353123 CGGTAGCAAGCCAAGTATTTTAAGA 59.647 40.000 0.00 0.00 0.00 2.10
94 97 2.361230 AAAGGCCGGTAGCAAGCC 60.361 61.111 13.70 13.70 46.50 4.35
115 118 2.159043 ACACTAGATGACTCGCCAATGG 60.159 50.000 0.00 0.00 0.00 3.16
174 182 0.888619 TGAACGATTCGTCCTGAGCT 59.111 50.000 12.80 0.00 39.99 4.09
1140 1221 2.251642 GCGACGTTTGCCCTTGAGT 61.252 57.895 2.57 0.00 0.00 3.41
1361 1442 2.432300 TAGGGCTTGAGGTAGGCGC 61.432 63.158 0.00 0.00 43.45 6.53
1776 1857 1.788229 TCGACATTATCTCTGGCCCA 58.212 50.000 0.00 0.00 0.00 5.36
1854 1935 1.413118 TGAAGATGATAGAGGGCGCA 58.587 50.000 10.83 0.00 0.00 6.09
2086 2167 2.987547 TTCGAGACGCCCGACCTT 60.988 61.111 0.00 0.00 35.61 3.50
2126 2207 1.307097 GTCCTCATCCAGCTTCATGC 58.693 55.000 0.00 0.00 43.29 4.06
2514 2596 2.994699 CATCCTGGTGGCCCGTAA 59.005 61.111 0.00 0.00 0.00 3.18
2694 2776 2.099143 GATGGAGTCGAGCTCGTCA 58.901 57.895 33.33 25.24 45.03 4.35
2767 2849 0.756294 TCGGTGAGAAGCTGGTTCAA 59.244 50.000 20.36 6.63 37.67 2.69
3275 3357 3.702048 CCGGGAAGCGGAACTCCA 61.702 66.667 0.00 0.00 35.14 3.86
3354 3442 4.352893 TCCTGGATCACTTGTACAGATCA 58.647 43.478 19.54 9.26 39.85 2.92
3428 3517 4.078639 AGTGGACAAAGAGGAAACAGAG 57.921 45.455 0.00 0.00 0.00 3.35
3430 3519 6.884280 ATAAAGTGGACAAAGAGGAAACAG 57.116 37.500 0.00 0.00 0.00 3.16
3653 4174 4.878439 AGCGTATAAGTGTCTGACAAACA 58.122 39.130 12.81 0.50 0.00 2.83
3872 4489 5.875359 GGAAGGTAGAATTCGACATGAAACT 59.125 40.000 18.70 4.47 40.71 2.66
4108 4762 2.432146 TGGCTAAGCTATCAGTCAGTGG 59.568 50.000 0.00 0.00 0.00 4.00
4234 4894 5.163332 GGGGTTCAGTTATTCTACGGAAGAT 60.163 44.000 0.00 0.00 33.86 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.