Multiple sequence alignment - TraesCS1D01G395000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G395000 chr1D 100.000 2578 0 0 1 2578 463801554 463798977 0.000000e+00 4761.0
1 TraesCS1D01G395000 chr1D 91.448 877 62 4 515 1381 417106074 417106947 0.000000e+00 1192.0
2 TraesCS1D01G395000 chr6D 92.774 2062 95 20 533 2578 297178753 297176730 0.000000e+00 2933.0
3 TraesCS1D01G395000 chr6D 92.894 1351 70 10 5 1331 446392195 446390847 0.000000e+00 1940.0
4 TraesCS1D01G395000 chr5D 91.500 2094 116 15 541 2578 140960527 140958440 0.000000e+00 2824.0
5 TraesCS1D01G395000 chr5D 94.175 1339 68 8 1246 2578 29808816 29807482 0.000000e+00 2032.0
6 TraesCS1D01G395000 chr5D 92.421 1425 78 12 5 1407 384519408 384517992 0.000000e+00 2006.0
7 TraesCS1D01G395000 chr5D 90.877 1425 73 17 5 1407 313520705 313519316 0.000000e+00 1858.0
8 TraesCS1D01G395000 chr5D 91.425 898 64 9 515 1407 29809490 29808601 0.000000e+00 1219.0
9 TraesCS1D01G395000 chr5D 94.141 256 13 1 214 469 20273473 20273220 3.110000e-104 388.0
10 TraesCS1D01G395000 chr2A 90.507 1991 125 31 5 1944 259675850 259677827 0.000000e+00 2571.0
11 TraesCS1D01G395000 chr2A 91.217 1685 116 12 279 1944 259577462 259579133 0.000000e+00 2263.0
12 TraesCS1D01G395000 chr2A 94.161 274 8 3 1 267 259577238 259577510 6.640000e-111 411.0
13 TraesCS1D01G395000 chr7B 90.773 1875 127 26 151 2004 122461222 122463071 0.000000e+00 2462.0
14 TraesCS1D01G395000 chr7B 92.051 868 63 6 516 1381 719338802 719337939 0.000000e+00 1216.0
15 TraesCS1D01G395000 chr7B 89.627 241 17 5 5 238 725302063 725302302 1.500000e-77 300.0
16 TraesCS1D01G395000 chr7D 94.516 1313 61 8 1274 2578 17943582 17942273 0.000000e+00 2015.0
17 TraesCS1D01G395000 chr7D 90.757 898 70 9 515 1407 103532616 103533505 0.000000e+00 1186.0
18 TraesCS1D01G395000 chr4A 93.888 1309 72 7 1274 2576 433609182 433607876 0.000000e+00 1967.0
19 TraesCS1D01G395000 chr5A 92.688 1313 84 8 1274 2578 235652651 235653959 0.000000e+00 1882.0
20 TraesCS1D01G395000 chr5A 92.182 1343 85 11 1246 2578 178867489 178866157 0.000000e+00 1881.0
21 TraesCS1D01G395000 chr5A 91.114 889 56 9 533 1407 178868151 178867272 0.000000e+00 1182.0
22 TraesCS1D01G395000 chr2B 92.857 1288 83 5 1300 2578 780644229 780645516 0.000000e+00 1860.0
23 TraesCS1D01G395000 chr3B 91.705 1314 95 9 1274 2578 329524773 329523465 0.000000e+00 1810.0
24 TraesCS1D01G395000 chr3B 92.940 949 54 6 418 1356 320731865 320730920 0.000000e+00 1369.0
25 TraesCS1D01G395000 chr3B 91.926 867 65 5 516 1381 787077867 787078729 0.000000e+00 1208.0
26 TraesCS1D01G395000 chr5B 91.133 1342 107 9 1247 2578 117419677 117421016 0.000000e+00 1808.0
27 TraesCS1D01G395000 chr5B 91.935 868 60 7 516 1381 150817217 150816358 0.000000e+00 1206.0
28 TraesCS1D01G395000 chr5B 90.625 896 76 6 516 1407 117419003 117419894 0.000000e+00 1182.0
29 TraesCS1D01G395000 chr7A 92.734 867 57 6 516 1381 734436720 734437581 0.000000e+00 1247.0
30 TraesCS1D01G395000 chr7A 94.268 471 19 4 5 469 220992657 220993125 0.000000e+00 713.0
31 TraesCS1D01G395000 chr7A 96.154 52 2 0 465 516 220993316 220993367 4.570000e-13 86.1
32 TraesCS1D01G395000 chr3D 91.537 898 63 9 515 1407 57607301 57608190 0.000000e+00 1225.0
33 TraesCS1D01G395000 chr3D 95.367 259 10 2 211 469 571760840 571760584 6.640000e-111 411.0
34 TraesCS1D01G395000 chr6B 84.855 997 104 19 465 1434 425131581 425132557 0.000000e+00 961.0
35 TraesCS1D01G395000 chr6B 88.542 192 16 3 5 190 425112530 425112721 7.180000e-56 228.0
36 TraesCS1D01G395000 chr4B 92.308 286 14 7 5 284 644593718 644594001 1.440000e-107 399.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G395000 chr1D 463798977 463801554 2577 True 4761.00 4761 100.000 1 2578 1 chr1D.!!$R1 2577
1 TraesCS1D01G395000 chr1D 417106074 417106947 873 False 1192.00 1192 91.448 515 1381 1 chr1D.!!$F1 866
2 TraesCS1D01G395000 chr6D 297176730 297178753 2023 True 2933.00 2933 92.774 533 2578 1 chr6D.!!$R1 2045
3 TraesCS1D01G395000 chr6D 446390847 446392195 1348 True 1940.00 1940 92.894 5 1331 1 chr6D.!!$R2 1326
4 TraesCS1D01G395000 chr5D 140958440 140960527 2087 True 2824.00 2824 91.500 541 2578 1 chr5D.!!$R2 2037
5 TraesCS1D01G395000 chr5D 384517992 384519408 1416 True 2006.00 2006 92.421 5 1407 1 chr5D.!!$R4 1402
6 TraesCS1D01G395000 chr5D 313519316 313520705 1389 True 1858.00 1858 90.877 5 1407 1 chr5D.!!$R3 1402
7 TraesCS1D01G395000 chr5D 29807482 29809490 2008 True 1625.50 2032 92.800 515 2578 2 chr5D.!!$R5 2063
8 TraesCS1D01G395000 chr2A 259675850 259677827 1977 False 2571.00 2571 90.507 5 1944 1 chr2A.!!$F1 1939
9 TraesCS1D01G395000 chr2A 259577238 259579133 1895 False 1337.00 2263 92.689 1 1944 2 chr2A.!!$F2 1943
10 TraesCS1D01G395000 chr7B 122461222 122463071 1849 False 2462.00 2462 90.773 151 2004 1 chr7B.!!$F1 1853
11 TraesCS1D01G395000 chr7B 719337939 719338802 863 True 1216.00 1216 92.051 516 1381 1 chr7B.!!$R1 865
12 TraesCS1D01G395000 chr7D 17942273 17943582 1309 True 2015.00 2015 94.516 1274 2578 1 chr7D.!!$R1 1304
13 TraesCS1D01G395000 chr7D 103532616 103533505 889 False 1186.00 1186 90.757 515 1407 1 chr7D.!!$F1 892
14 TraesCS1D01G395000 chr4A 433607876 433609182 1306 True 1967.00 1967 93.888 1274 2576 1 chr4A.!!$R1 1302
15 TraesCS1D01G395000 chr5A 235652651 235653959 1308 False 1882.00 1882 92.688 1274 2578 1 chr5A.!!$F1 1304
16 TraesCS1D01G395000 chr5A 178866157 178868151 1994 True 1531.50 1881 91.648 533 2578 2 chr5A.!!$R1 2045
17 TraesCS1D01G395000 chr2B 780644229 780645516 1287 False 1860.00 1860 92.857 1300 2578 1 chr2B.!!$F1 1278
18 TraesCS1D01G395000 chr3B 329523465 329524773 1308 True 1810.00 1810 91.705 1274 2578 1 chr3B.!!$R2 1304
19 TraesCS1D01G395000 chr3B 320730920 320731865 945 True 1369.00 1369 92.940 418 1356 1 chr3B.!!$R1 938
20 TraesCS1D01G395000 chr3B 787077867 787078729 862 False 1208.00 1208 91.926 516 1381 1 chr3B.!!$F1 865
21 TraesCS1D01G395000 chr5B 117419003 117421016 2013 False 1495.00 1808 90.879 516 2578 2 chr5B.!!$F1 2062
22 TraesCS1D01G395000 chr5B 150816358 150817217 859 True 1206.00 1206 91.935 516 1381 1 chr5B.!!$R1 865
23 TraesCS1D01G395000 chr7A 734436720 734437581 861 False 1247.00 1247 92.734 516 1381 1 chr7A.!!$F1 865
24 TraesCS1D01G395000 chr7A 220992657 220993367 710 False 399.55 713 95.211 5 516 2 chr7A.!!$F2 511
25 TraesCS1D01G395000 chr3D 57607301 57608190 889 False 1225.00 1225 91.537 515 1407 1 chr3D.!!$F1 892
26 TraesCS1D01G395000 chr6B 425131581 425132557 976 False 961.00 961 84.855 465 1434 1 chr6B.!!$F2 969

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1044 1328 0.246635 ACGACGATGCCAGTAAGCTT 59.753 50.0 3.48 3.48 0.0 3.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2134 2768 1.185315 CAAATTCCAGCCGGTTCCAT 58.815 50.0 1.9 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1044 1328 0.246635 ACGACGATGCCAGTAAGCTT 59.753 50.000 3.48 3.48 0.00 3.74
1185 1690 1.000993 AGGGATGACGAGGAGCAGT 59.999 57.895 0.00 0.00 0.00 4.40
1245 1750 1.521681 GACGACCCTGCTATGGTGC 60.522 63.158 0.00 0.00 35.85 5.01
1297 1883 1.664321 GACGACGACCCTGCTATGGT 61.664 60.000 0.00 0.00 39.32 3.55
1298 1884 1.226974 CGACGACCCTGCTATGGTG 60.227 63.158 0.00 0.00 35.85 4.17
1304 1890 2.898840 CCTGCTATGGTGCTGGCG 60.899 66.667 0.00 0.00 43.21 5.69
1361 1947 2.329539 CTGCTATGGTGGTGGCGGAT 62.330 60.000 0.00 0.00 34.22 4.18
1426 2042 0.734889 CCCAATGATGACCTCGCAAC 59.265 55.000 0.00 0.00 0.00 4.17
1450 2066 1.021390 GTGCCTGACAATGACCTCGG 61.021 60.000 0.00 0.00 0.00 4.63
1646 2275 7.602517 AGCTTGTTAGTGTAATCTGAACATC 57.397 36.000 0.00 0.00 30.61 3.06
1670 2299 8.918202 TCTCAATGTTAAGTATGTCAGGTTTT 57.082 30.769 0.00 0.00 0.00 2.43
1881 2514 6.547880 TGCTAAAAACATGACTCAAACCCTAA 59.452 34.615 0.00 0.00 0.00 2.69
2134 2768 1.218047 CACCTTCGGCCGATTCAGA 59.782 57.895 31.56 13.13 0.00 3.27
2213 2849 6.397272 TCCAAAAATCATTTTAGCTTCGCAT 58.603 32.000 0.00 0.00 36.62 4.73
2431 3075 8.742554 ACTAGTGTTTTCTTGAAAAAGTGTTG 57.257 30.769 9.71 3.46 0.00 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 8.385491 TGCCCATATCTACAAATGAACATATCT 58.615 33.333 0.00 0.00 0.00 1.98
28 29 8.385491 TCTGCCCATATCTACAAATGAACATAT 58.615 33.333 0.00 0.00 0.00 1.78
29 30 7.744733 TCTGCCCATATCTACAAATGAACATA 58.255 34.615 0.00 0.00 0.00 2.29
31 32 6.000246 TCTGCCCATATCTACAAATGAACA 58.000 37.500 0.00 0.00 0.00 3.18
32 33 8.671921 CATATCTGCCCATATCTACAAATGAAC 58.328 37.037 0.00 0.00 0.00 3.18
34 35 7.037370 ACCATATCTGCCCATATCTACAAATGA 60.037 37.037 0.00 0.00 0.00 2.57
35 36 7.114754 ACCATATCTGCCCATATCTACAAATG 58.885 38.462 0.00 0.00 0.00 2.32
36 37 7.276088 ACCATATCTGCCCATATCTACAAAT 57.724 36.000 0.00 0.00 0.00 2.32
37 38 6.296432 GGACCATATCTGCCCATATCTACAAA 60.296 42.308 0.00 0.00 0.00 2.83
38 39 5.189736 GGACCATATCTGCCCATATCTACAA 59.810 44.000 0.00 0.00 0.00 2.41
45 52 6.718593 ATAAAAGGACCATATCTGCCCATA 57.281 37.500 0.00 0.00 0.00 2.74
244 251 7.307131 ACTTCAGAAACCATCAAATTTGGAT 57.693 32.000 17.90 7.66 37.69 3.41
585 830 4.041444 AGCCATCTCACTTCTCTGAAAAGT 59.959 41.667 0.00 0.00 37.44 2.66
1044 1328 4.044825 AGGACAGGAAGAAGAGAGGTAGAA 59.955 45.833 0.00 0.00 0.00 2.10
1185 1690 1.400846 GTCGTCGTCAGCCAGAATAGA 59.599 52.381 0.00 0.00 0.00 1.98
1245 1750 1.811266 CAAGGTCGTCATCCGCCAG 60.811 63.158 0.00 0.00 35.87 4.85
1297 1883 4.451150 GGTCGTCATCCGCCAGCA 62.451 66.667 0.00 0.00 36.19 4.41
1298 1884 3.665675 AAGGTCGTCATCCGCCAGC 62.666 63.158 0.00 0.00 35.87 4.85
1304 1890 1.139058 ACCATAGCAAGGTCGTCATCC 59.861 52.381 0.00 0.00 32.90 3.51
1361 1947 0.108186 CCACCATAGCAAGCTCGTCA 60.108 55.000 0.00 0.00 0.00 4.35
1367 1953 0.666913 CATCAGCCACCATAGCAAGC 59.333 55.000 0.00 0.00 0.00 4.01
1426 2042 1.302431 TCATTGTCAGGCACCACCG 60.302 57.895 0.00 0.00 46.52 4.94
1670 2299 4.738243 GCATCCATGAGCATGCACAAAATA 60.738 41.667 21.69 8.35 44.18 1.40
1854 2487 5.634859 GGGTTTGAGTCATGTTTTTAGCATG 59.365 40.000 0.00 0.00 43.55 4.06
2134 2768 1.185315 CAAATTCCAGCCGGTTCCAT 58.815 50.000 1.90 0.00 0.00 3.41
2210 2846 5.252969 TCTTTGATGAAATGCCTACATGC 57.747 39.130 0.00 0.00 36.36 4.06
2213 2849 5.879777 TCGATTCTTTGATGAAATGCCTACA 59.120 36.000 0.00 0.00 0.00 2.74
2431 3075 4.609783 CGTTCATGGTAGGTCGTTTTTGAC 60.610 45.833 0.00 0.00 38.17 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.