Multiple sequence alignment - TraesCS1D01G387400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G387400 chr1D 100.000 2372 0 0 1 2372 459904520 459902149 0 4381
1 TraesCS1D01G387400 chr3A 98.820 2372 28 0 1 2372 66004936 66002565 0 4226
2 TraesCS1D01G387400 chr6D 98.651 2372 32 0 1 2372 389245625 389243254 0 4204
3 TraesCS1D01G387400 chr5D 98.651 2372 32 0 1 2372 503264579 503262208 0 4204
4 TraesCS1D01G387400 chr5D 98.567 2372 34 0 1 2372 503245469 503247840 0 4193
5 TraesCS1D01G387400 chr2A 98.609 2372 33 0 1 2372 726906258 726903887 0 4198
6 TraesCS1D01G387400 chr2D 98.567 2372 34 0 1 2372 591984806 591987177 0 4193
7 TraesCS1D01G387400 chr3D 98.567 2372 33 1 1 2372 589263329 589260959 0 4191
8 TraesCS1D01G387400 chr7B 98.398 2372 38 0 1 2372 663099228 663096857 0 4170
9 TraesCS1D01G387400 chr3B 98.187 2372 41 2 1 2372 201539719 201542088 0 4141


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G387400 chr1D 459902149 459904520 2371 True 4381 4381 100.000 1 2372 1 chr1D.!!$R1 2371
1 TraesCS1D01G387400 chr3A 66002565 66004936 2371 True 4226 4226 98.820 1 2372 1 chr3A.!!$R1 2371
2 TraesCS1D01G387400 chr6D 389243254 389245625 2371 True 4204 4204 98.651 1 2372 1 chr6D.!!$R1 2371
3 TraesCS1D01G387400 chr5D 503262208 503264579 2371 True 4204 4204 98.651 1 2372 1 chr5D.!!$R1 2371
4 TraesCS1D01G387400 chr5D 503245469 503247840 2371 False 4193 4193 98.567 1 2372 1 chr5D.!!$F1 2371
5 TraesCS1D01G387400 chr2A 726903887 726906258 2371 True 4198 4198 98.609 1 2372 1 chr2A.!!$R1 2371
6 TraesCS1D01G387400 chr2D 591984806 591987177 2371 False 4193 4193 98.567 1 2372 1 chr2D.!!$F1 2371
7 TraesCS1D01G387400 chr3D 589260959 589263329 2370 True 4191 4191 98.567 1 2372 1 chr3D.!!$R1 2371
8 TraesCS1D01G387400 chr7B 663096857 663099228 2371 True 4170 4170 98.398 1 2372 1 chr7B.!!$R1 2371
9 TraesCS1D01G387400 chr3B 201539719 201542088 2369 False 4141 4141 98.187 1 2372 1 chr3B.!!$F1 2371

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
194 195 1.589716 GCTCCGCTCTTGCAATTGGT 61.59 55.0 7.72 0.0 39.64 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1987 1988 0.603569 CTAGCTCTGGGTTCGTGTGT 59.396 55.0 0.0 0.0 0.0 3.72 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
194 195 1.589716 GCTCCGCTCTTGCAATTGGT 61.590 55.000 7.72 0.0 39.64 3.67
340 341 5.308237 ACTCTACTGAGACAAAAAGATGGGT 59.692 40.000 0.00 0.0 42.73 4.51
753 754 3.513912 TCTTAAGATCAAAGAGTCGGGCA 59.486 43.478 0.00 0.0 0.00 5.36
1167 1168 4.603610 ACCTTAGGATGGCATAGCCTTAAT 59.396 41.667 12.47 0.0 44.62 1.40
1702 1703 4.019681 CCCAGTGGGTAGTGAAATAGAACA 60.020 45.833 21.24 0.0 38.25 3.18
1750 1751 2.317900 TGGGAGGGGAAAGTGATCTCTA 59.682 50.000 0.00 0.0 0.00 2.43
1925 1926 5.649831 GGATGAAGCTTGGATGAAACTAAGT 59.350 40.000 2.10 0.0 32.34 2.24
1987 1988 3.139397 AGTTGTGGTTAGGGGTGAAATGA 59.861 43.478 0.00 0.0 0.00 2.57
1991 1992 2.443632 TGGTTAGGGGTGAAATGACACA 59.556 45.455 0.00 0.0 41.88 3.72
2102 2104 3.481661 CGCGAGCGGTACCAAATT 58.518 55.556 13.54 0.0 35.56 1.82
2258 2260 2.196595 CAGTGATAAAGGAGGTGGGGA 58.803 52.381 0.00 0.0 0.00 4.81
2362 2364 1.906574 TGAAGATGAACGGGGCTAAGT 59.093 47.619 0.00 0.0 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
194 195 0.791422 CAACCCGTAATCGCAACGAA 59.209 50.000 5.73 0.00 42.90 3.85
340 341 5.012768 CCTACCTCCTCTACCTTTTTGACAA 59.987 44.000 0.00 0.00 0.00 3.18
395 396 4.023107 CGACTCCAACTATCGTCCATGTAT 60.023 45.833 0.00 0.00 0.00 2.29
420 421 1.383248 GGGAAGCCTAGGAGAGCCA 60.383 63.158 14.75 0.00 36.29 4.75
1167 1168 4.138290 TCTTTTGAACCTCGCCATTAACA 58.862 39.130 0.00 0.00 0.00 2.41
1579 1580 2.923121 CTGATTCACACGGGATTCCAT 58.077 47.619 4.80 0.00 0.00 3.41
1702 1703 0.674895 GGAGCTCAGCACGGTTTCAT 60.675 55.000 17.19 0.00 0.00 2.57
1750 1751 2.515057 TTCAACAGGCACGCGGTT 60.515 55.556 12.47 0.58 0.00 4.44
1838 1839 5.104900 AGTGACAATCGCCCTATTAAGACTT 60.105 40.000 0.00 0.00 0.00 3.01
1925 1926 2.873094 TCAGTCGGTTCAGACCTCTA 57.127 50.000 0.02 0.00 44.20 2.43
1987 1988 0.603569 CTAGCTCTGGGTTCGTGTGT 59.396 55.000 0.00 0.00 0.00 3.72
1991 1992 1.893786 CAGCTAGCTCTGGGTTCGT 59.106 57.895 16.15 0.00 0.00 3.85
2045 2046 3.054655 GTGCTTTACCCCTAGATGTCCAA 60.055 47.826 0.00 0.00 0.00 3.53
2102 2104 6.798427 ATCTAGTATTCAGAGTTTGCCTCA 57.202 37.500 0.00 0.00 43.12 3.86
2258 2260 0.323178 CCTCCTGGCTGTCTTTGCAT 60.323 55.000 0.00 0.00 0.00 3.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.