Multiple sequence alignment - TraesCS1D01G363200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G363200 chr1D 100.000 2795 0 0 1 2795 444918285 444915491 0 5162
1 TraesCS1D01G363200 chr1D 98.177 2798 42 6 1 2795 80994539 80997330 0 4876
2 TraesCS1D01G363200 chr7D 98.534 2796 36 4 1 2795 254130806 254133597 0 4931
3 TraesCS1D01G363200 chr3D 98.357 2799 40 5 1 2795 555598080 555595284 0 4909
4 TraesCS1D01G363200 chr3D 98.212 2796 42 5 1 2795 330713372 330710584 0 4879
5 TraesCS1D01G363200 chr3D 97.968 2805 41 9 1 2795 536967146 536969944 0 4850
6 TraesCS1D01G363200 chr3D 97.891 2797 52 6 1 2795 11680918 11678127 0 4831
7 TraesCS1D01G363200 chr6D 98.111 2805 41 6 1 2795 82551278 82554080 0 4876
8 TraesCS1D01G363200 chr5D 97.929 2800 48 6 1 2795 349805605 349808399 0 4841


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G363200 chr1D 444915491 444918285 2794 True 5162 5162 100.000 1 2795 1 chr1D.!!$R1 2794
1 TraesCS1D01G363200 chr1D 80994539 80997330 2791 False 4876 4876 98.177 1 2795 1 chr1D.!!$F1 2794
2 TraesCS1D01G363200 chr7D 254130806 254133597 2791 False 4931 4931 98.534 1 2795 1 chr7D.!!$F1 2794
3 TraesCS1D01G363200 chr3D 555595284 555598080 2796 True 4909 4909 98.357 1 2795 1 chr3D.!!$R3 2794
4 TraesCS1D01G363200 chr3D 330710584 330713372 2788 True 4879 4879 98.212 1 2795 1 chr3D.!!$R2 2794
5 TraesCS1D01G363200 chr3D 536967146 536969944 2798 False 4850 4850 97.968 1 2795 1 chr3D.!!$F1 2794
6 TraesCS1D01G363200 chr3D 11678127 11680918 2791 True 4831 4831 97.891 1 2795 1 chr3D.!!$R1 2794
7 TraesCS1D01G363200 chr6D 82551278 82554080 2802 False 4876 4876 98.111 1 2795 1 chr6D.!!$F1 2794
8 TraesCS1D01G363200 chr5D 349805605 349808399 2794 False 4841 4841 97.929 1 2795 1 chr5D.!!$F1 2794

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
103 111 0.39382 TTTTTCGTAGGTGCTCCGGT 59.606 50.0 0.0 0.0 39.05 5.28 F
422 430 0.53109 TTGACACGTACACAGGTGCC 60.531 55.0 0.0 0.0 42.93 5.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1793 1815 1.526575 CCTTTGCGTGGACATTGCCT 61.527 55.000 0.00 0.0 0.00 4.75 R
2230 2252 4.558226 ACTCTGGCATGAACATGTCTTA 57.442 40.909 17.99 7.3 43.47 2.10 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 61 1.878975 TTCTTCGTTCGCACGCACA 60.879 52.632 1.72 0.00 46.70 4.57
103 111 0.393820 TTTTTCGTAGGTGCTCCGGT 59.606 50.000 0.00 0.00 39.05 5.28
111 119 2.742428 AGGTGCTCCGGTAGTATACA 57.258 50.000 0.00 0.00 45.43 2.29
380 388 7.392113 TGTGAATTGTATTAGTTGTTAGTGGGG 59.608 37.037 0.00 0.00 0.00 4.96
422 430 0.531090 TTGACACGTACACAGGTGCC 60.531 55.000 0.00 0.00 42.93 5.01
667 682 6.664428 AGTTTAACCCATAACAAGCAATGT 57.336 33.333 0.00 0.00 46.82 2.71
1383 1405 0.804156 GCTACGAAGGACAGAGCAGC 60.804 60.000 0.00 0.00 33.26 5.25
1433 1455 1.423395 GAACAAGGACAGAGCAGTCG 58.577 55.000 0.00 0.00 39.42 4.18
1503 1525 2.093128 GGTAGAAGGAGGAAATGCCGAA 60.093 50.000 0.00 0.00 43.43 4.30
1567 1589 2.821378 CACATGCAGAACCAGATGGAAA 59.179 45.455 5.72 0.00 38.94 3.13
1793 1815 7.729881 AGCCCTGAAGGATGCAATAATTAATTA 59.270 33.333 10.27 10.27 38.24 1.40
2006 2028 2.689553 TCATCCACGCTTATTGCTCA 57.310 45.000 0.00 0.00 40.11 4.26
2230 2252 5.130705 TCCAGGCACCTATATCGATATCT 57.869 43.478 20.95 8.51 0.00 1.98
2638 2660 2.825387 GGTGCATGCGCCATCTCA 60.825 61.111 38.94 5.64 45.34 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
12 13 1.861971 AGAACCACGAACGAAGAACC 58.138 50.000 0.14 0.00 0.00 3.62
53 61 4.229582 TGGGCTGAAATATACCCTTGAAGT 59.770 41.667 0.00 0.00 43.25 3.01
111 119 6.079424 ACCGCGGCAAATAACAATATTTAT 57.921 33.333 28.58 0.00 39.21 1.40
165 173 5.011943 TCCGTATACTACCGGGCAAAATAAT 59.988 40.000 6.32 0.00 44.32 1.28
172 180 1.774110 TTTCCGTATACTACCGGGCA 58.226 50.000 6.32 0.00 44.32 5.36
422 430 6.494893 TTCATGTTTCCAACTTCTTATCCG 57.505 37.500 0.00 0.00 0.00 4.18
1098 1120 2.419057 TTTGTGGTGCGCTGATTGCC 62.419 55.000 9.73 1.86 38.78 4.52
1383 1405 4.162040 AGCATTTCCTCCTTCTACATGG 57.838 45.455 0.00 0.00 0.00 3.66
1433 1455 3.653835 AAGCATTTCCTCCTTCTACCC 57.346 47.619 0.00 0.00 0.00 3.69
1503 1525 1.559682 ACCTCGCCATTGTAATCACCT 59.440 47.619 0.00 0.00 0.00 4.00
1567 1589 4.275936 CCTTTCAACATCGGTGTCTTCTTT 59.724 41.667 0.00 0.00 37.67 2.52
1793 1815 1.526575 CCTTTGCGTGGACATTGCCT 61.527 55.000 0.00 0.00 0.00 4.75
2006 2028 6.163476 TGCACTATCTCATCGTAAAACAGTT 58.837 36.000 0.00 0.00 0.00 3.16
2230 2252 4.558226 ACTCTGGCATGAACATGTCTTA 57.442 40.909 17.99 7.30 43.47 2.10
2638 2660 2.237392 ACTGCGAGAAGAAATTAGCCCT 59.763 45.455 0.00 0.00 0.00 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.