Multiple sequence alignment - TraesCS1D01G358000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G358000 chr1D 100.000 2646 0 0 1 2646 441737641 441740286 0.000000e+00 4887
1 TraesCS1D01G358000 chr1D 91.662 1943 150 11 1 1937 441575925 441577861 0.000000e+00 2680
2 TraesCS1D01G358000 chr1D 92.807 1863 64 40 824 2646 441630801 441632633 0.000000e+00 2634
3 TraesCS1D01G358000 chr1D 97.262 767 21 0 1 767 441630037 441630803 0.000000e+00 1301
4 TraesCS1D01G358000 chr1D 90.871 241 21 1 1929 2169 441577892 441578131 3.290000e-84 322
5 TraesCS1D01G358000 chr1B 97.579 1941 41 5 1 1937 599834394 599836332 0.000000e+00 3319
6 TraesCS1D01G358000 chr1B 97.476 1941 43 5 1 1937 599633679 599635617 0.000000e+00 3308
7 TraesCS1D01G358000 chr1B 97.424 1941 44 5 1 1937 599980248 599982186 0.000000e+00 3302
8 TraesCS1D01G358000 chr1B 97.372 1941 44 5 1 1937 599704888 599706825 0.000000e+00 3295
9 TraesCS1D01G358000 chr1B 97.166 1941 49 5 1 1937 599922933 599924871 0.000000e+00 3275
10 TraesCS1D01G358000 chr1B 96.649 1940 58 6 1 1937 599575352 599577287 0.000000e+00 3216
11 TraesCS1D01G358000 chr1B 97.396 1805 42 4 137 1937 599762984 599764787 0.000000e+00 3068
12 TraesCS1D01G358000 chr1B 97.087 721 16 2 1927 2646 599635646 599636362 0.000000e+00 1210
13 TraesCS1D01G358000 chr1B 96.671 721 19 2 1927 2646 599706854 599707570 0.000000e+00 1194
14 TraesCS1D01G358000 chr1B 96.533 721 20 2 1927 2646 599764816 599765532 0.000000e+00 1188
15 TraesCS1D01G358000 chr1B 96.409 724 16 2 1924 2646 599836358 599837072 0.000000e+00 1184
16 TraesCS1D01G358000 chr1B 95.533 403 18 0 1927 2329 599982215 599982617 0.000000e+00 645
17 TraesCS1D01G358000 chr1B 94.947 376 19 0 1927 2302 599924899 599925274 8.160000e-165 590
18 TraesCS1D01G358000 chr1B 96.122 361 10 4 1927 2286 599577316 599577673 1.060000e-163 586
19 TraesCS1D01G358000 chr1B 99.353 309 2 0 2338 2646 599925579 599925887 6.400000e-156 560
20 TraesCS1D01G358000 chr1B 99.029 309 3 0 2338 2646 599982767 599983075 2.980000e-154 555
21 TraesCS1D01G358000 chr1B 97.849 93 0 2 2551 2643 599577664 599577754 2.730000e-35 159
22 TraesCS1D01G358000 chr5D 82.286 175 26 5 2106 2277 330312250 330312078 2.120000e-31 147


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G358000 chr1D 441737641 441740286 2645 False 4887.000000 4887 100.000000 1 2646 1 chr1D.!!$F1 2645
1 TraesCS1D01G358000 chr1D 441630037 441632633 2596 False 1967.500000 2634 95.034500 1 2646 2 chr1D.!!$F3 2645
2 TraesCS1D01G358000 chr1D 441575925 441578131 2206 False 1501.000000 2680 91.266500 1 2169 2 chr1D.!!$F2 2168
3 TraesCS1D01G358000 chr1B 599633679 599636362 2683 False 2259.000000 3308 97.281500 1 2646 2 chr1B.!!$F2 2645
4 TraesCS1D01G358000 chr1B 599834394 599837072 2678 False 2251.500000 3319 96.994000 1 2646 2 chr1B.!!$F5 2645
5 TraesCS1D01G358000 chr1B 599704888 599707570 2682 False 2244.500000 3295 97.021500 1 2646 2 chr1B.!!$F3 2645
6 TraesCS1D01G358000 chr1B 599762984 599765532 2548 False 2128.000000 3068 96.964500 137 2646 2 chr1B.!!$F4 2509
7 TraesCS1D01G358000 chr1B 599980248 599983075 2827 False 1500.666667 3302 97.328667 1 2646 3 chr1B.!!$F7 2645
8 TraesCS1D01G358000 chr1B 599922933 599925887 2954 False 1475.000000 3275 97.155333 1 2646 3 chr1B.!!$F6 2645
9 TraesCS1D01G358000 chr1B 599575352 599577754 2402 False 1320.333333 3216 96.873333 1 2643 3 chr1B.!!$F1 2642

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
856 863 1.281867 GTCATGATCCTCCACACCCAA 59.718 52.381 0.0 0.0 0.0 4.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1715 1725 7.201496 CGTATAAAACACTAGCGGAACAAGAAT 60.201 37.037 0.0 0.0 0.0 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 2.021042 AGAGGGGGAAATGAGGTATGGA 60.021 50.000 0.00 0.00 0.00 3.41
113 114 5.014202 ACTCCCCACATTTGTTTGGTATAC 58.986 41.667 0.00 0.00 0.00 1.47
122 123 8.967218 CACATTTGTTTGGTATACTTTGTCAAG 58.033 33.333 2.25 0.00 35.92 3.02
169 170 5.182950 TGTCCTGCAATCATATTTGTTTCGT 59.817 36.000 0.00 0.00 0.00 3.85
200 204 1.464997 GTGAAGTCTTCCACAATCGGC 59.535 52.381 10.12 0.00 33.72 5.54
219 223 6.194796 TCGGCTCAAAATGAAGAATTAAGG 57.805 37.500 0.00 0.00 0.00 2.69
242 246 8.004087 AGGATTTGGATGTAATTCATTGTGAG 57.996 34.615 0.00 0.00 36.83 3.51
286 291 5.810587 GCTTTTGTGCATGAGATTCATCATT 59.189 36.000 0.00 0.00 37.84 2.57
406 411 3.699038 GGTTAAGCCACTATTGATTGCCA 59.301 43.478 0.00 0.00 37.17 4.92
438 443 6.545666 CCATATACTTTTGCATTAGTGGTGGA 59.454 38.462 10.55 0.00 0.00 4.02
685 692 2.356022 CCACTCCATATGCCTTGTGTGA 60.356 50.000 11.23 0.00 0.00 3.58
856 863 1.281867 GTCATGATCCTCCACACCCAA 59.718 52.381 0.00 0.00 0.00 4.12
1044 1053 0.752054 CACCACCCAAAAGTGCACAT 59.248 50.000 21.04 3.48 36.38 3.21
1112 1121 1.371558 GCCGTGAGAAGGTGGACTT 59.628 57.895 0.00 0.00 43.65 3.01
1171 1180 2.206900 TGGGCCAGGAGAAGGTGA 59.793 61.111 0.00 0.00 0.00 4.02
1411 1420 7.061752 TCTATGTAGTATGTCGATCGATGTG 57.938 40.000 22.50 0.00 0.00 3.21
1521 1531 3.876914 TGTGAGCGGCTCAAAATATTAGG 59.123 43.478 32.30 0.00 42.46 2.69
1715 1725 3.636300 AGTGCTATGTTGTTTGCCTTTCA 59.364 39.130 0.00 0.00 0.00 2.69
2320 2377 4.898861 TCATATAATTTCCCCTTTGGCACC 59.101 41.667 0.00 0.00 0.00 5.01
2551 2877 6.811954 TGTCAAAATCCATGTACGCTATCTA 58.188 36.000 0.00 0.00 0.00 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 0.850100 TGTGGGGAGTGTGGACAAAT 59.150 50.000 0.00 0.00 0.00 2.32
169 170 4.019411 TGGAAGACTTCACATCCTGCAATA 60.019 41.667 16.85 0.00 33.02 1.90
263 267 7.167635 GCTAATGATGAATCTCATGCACAAAAG 59.832 37.037 0.00 0.00 37.20 2.27
406 411 8.220559 ACTAATGCAAAAGTATATGGGAGACAT 58.779 33.333 2.65 0.00 43.68 3.06
438 443 5.957798 CACAACATGTGCCAAAATCTAGAT 58.042 37.500 0.00 0.00 41.89 1.98
685 692 1.896465 GTCTCACAGCCTTGGTACTCT 59.104 52.381 0.00 0.00 0.00 3.24
856 863 2.111043 CAACCCTGTGACGGCACT 59.889 61.111 24.38 0.00 45.36 4.40
1044 1053 3.703921 TGTGTACCTGCCTCACTGTATA 58.296 45.455 0.00 0.00 33.82 1.47
1171 1180 1.213678 CATCCTCATGGTGTGGTGGAT 59.786 52.381 0.00 0.00 40.01 3.41
1521 1531 7.196331 ACATGAGCAAAACTAGTTCAAAGAAC 58.804 34.615 8.95 1.77 30.07 3.01
1715 1725 7.201496 CGTATAAAACACTAGCGGAACAAGAAT 60.201 37.037 0.00 0.00 0.00 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.