Multiple sequence alignment - TraesCS1D01G357800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G357800 chr1D 100.000 2644 0 0 1 2644 441629996 441632639 0.000000e+00 4883.0
1 TraesCS1D01G357800 chr1D 92.830 1869 64 40 806 2644 441738464 441740292 0.000000e+00 2645.0
2 TraesCS1D01G357800 chr1D 92.121 1320 95 8 806 2122 441576752 441578065 0.000000e+00 1853.0
3 TraesCS1D01G357800 chr1D 97.030 808 24 0 1 808 441737600 441738407 0.000000e+00 1360.0
4 TraesCS1D01G357800 chr1D 91.492 811 63 5 1 806 441575884 441576693 0.000000e+00 1110.0
5 TraesCS1D01G357800 chr1B 95.608 1867 49 12 806 2644 599835217 599837078 0.000000e+00 2963.0
6 TraesCS1D01G357800 chr1B 95.256 1876 43 14 806 2644 599634502 599636368 0.000000e+00 2929.0
7 TraesCS1D01G357800 chr1B 95.152 1877 43 14 806 2644 599763672 599765538 0.000000e+00 2918.0
8 TraesCS1D01G357800 chr1B 94.989 1876 47 13 806 2644 599705711 599707576 0.000000e+00 2900.0
9 TraesCS1D01G357800 chr1B 95.490 1552 42 9 806 2334 599981071 599982617 0.000000e+00 2453.0
10 TraesCS1D01G357800 chr1B 95.213 1525 44 12 806 2307 599923756 599925274 0.000000e+00 2385.0
11 TraesCS1D01G357800 chr1B 94.674 1502 53 16 806 2284 599576174 599577671 0.000000e+00 2305.0
12 TraesCS1D01G357800 chr1B 97.525 808 19 1 1 808 599575311 599576117 0.000000e+00 1380.0
13 TraesCS1D01G357800 chr1B 97.404 809 19 2 1 808 599704847 599705654 0.000000e+00 1376.0
14 TraesCS1D01G357800 chr1B 97.281 809 20 2 1 808 599633638 599634445 0.000000e+00 1371.0
15 TraesCS1D01G357800 chr1B 97.281 809 20 2 1 808 599834353 599835160 0.000000e+00 1371.0
16 TraesCS1D01G357800 chr1B 97.157 809 21 2 1 808 599980207 599981014 0.000000e+00 1365.0
17 TraesCS1D01G357800 chr1B 96.910 809 23 2 1 808 599922892 599923699 0.000000e+00 1354.0
18 TraesCS1D01G357800 chr1B 97.152 632 17 1 178 808 599762984 599763615 0.000000e+00 1066.0
19 TraesCS1D01G357800 chr1B 94.603 315 4 1 2343 2644 599925579 599925893 2.380000e-130 475.0
20 TraesCS1D01G357800 chr1B 94.603 315 4 1 2343 2644 599982767 599983081 2.380000e-130 475.0
21 TraesCS1D01G357800 chr1B 94.898 98 3 2 2547 2644 599577667 599577762 4.560000e-33 152.0
22 TraesCS1D01G357800 chr1B 94.118 51 3 0 1 51 599762939 599762989 7.850000e-11 78.7
23 TraesCS1D01G357800 chr5A 85.714 133 17 2 2133 2263 426551291 426551423 3.550000e-29 139.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G357800 chr1D 441629996 441632639 2643 False 4883.000000 4883 100.000000 1 2644 1 chr1D.!!$F1 2643
1 TraesCS1D01G357800 chr1D 441737600 441740292 2692 False 2002.500000 2645 94.930000 1 2644 2 chr1D.!!$F3 2643
2 TraesCS1D01G357800 chr1D 441575884 441578065 2181 False 1481.500000 1853 91.806500 1 2122 2 chr1D.!!$F2 2121
3 TraesCS1D01G357800 chr1B 599834353 599837078 2725 False 2167.000000 2963 96.444500 1 2644 2 chr1B.!!$F5 2643
4 TraesCS1D01G357800 chr1B 599633638 599636368 2730 False 2150.000000 2929 96.268500 1 2644 2 chr1B.!!$F2 2643
5 TraesCS1D01G357800 chr1B 599704847 599707576 2729 False 2138.000000 2900 96.196500 1 2644 2 chr1B.!!$F3 2643
6 TraesCS1D01G357800 chr1B 599980207 599983081 2874 False 1431.000000 2453 95.750000 1 2644 3 chr1B.!!$F7 2643
7 TraesCS1D01G357800 chr1B 599922892 599925893 3001 False 1404.666667 2385 95.575333 1 2644 3 chr1B.!!$F6 2643
8 TraesCS1D01G357800 chr1B 599762939 599765538 2599 False 1354.233333 2918 95.474000 1 2644 3 chr1B.!!$F4 2643
9 TraesCS1D01G357800 chr1B 599575311 599577762 2451 False 1279.000000 2305 95.699000 1 2644 3 chr1B.!!$F1 2643

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
988 1057 1.366111 CCCGTCGATTTCCACGCATT 61.366 55.0 0.0 0.0 34.58 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2609 2984 2.098117 GGCAAATCTCAAATCAGACCCG 59.902 50.0 0.0 0.0 0.0 5.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
86 87 4.021807 TGCTGCTAATCATATTGCCCATTG 60.022 41.667 0.00 0.0 0.00 2.82
368 374 2.108075 TCAATCCTGAAAGAAGCCACCA 59.892 45.455 0.00 0.0 34.07 4.17
705 713 2.315925 AGACGTAGGCAATCCATGTG 57.684 50.000 0.00 0.0 33.74 3.21
726 734 2.019249 CACTCCATATGCCTTGTGTGG 58.981 52.381 0.00 0.0 0.00 4.17
988 1057 1.366111 CCCGTCGATTTCCACGCATT 61.366 55.000 0.00 0.0 34.58 3.56
1124 1194 1.000843 GTGAAGCCCCAAATGTTGACC 59.999 52.381 0.00 0.0 0.00 4.02
1191 1261 0.318762 GACCGACAAGCTCAAGGTCT 59.681 55.000 17.87 0.0 45.68 3.85
1438 1509 5.725110 AACTTAAGCATATGTCTCTTGCG 57.275 39.130 1.29 0.0 41.22 4.85
1610 1682 6.378564 TGAACAGTGGTTTCTTTTATGGTGAA 59.621 34.615 0.00 0.0 37.36 3.18
1650 1722 7.683746 ACAAATGTTGTGTGTAATTTTGCTTC 58.316 30.769 0.00 0.0 43.48 3.86
1844 1919 6.314896 CCAAACAGCTTTTGTATTTGTTCCAA 59.685 34.615 15.52 0.0 39.73 3.53
1845 1920 7.148340 CCAAACAGCTTTTGTATTTGTTCCAAA 60.148 33.333 15.52 0.0 39.73 3.28
2215 2308 7.095481 GCAATCTAGATCGCTTGATTAACATGA 60.095 37.037 8.46 0.0 42.17 3.07
2327 2420 7.534852 TCATATAATTTCCCCTTTGGCACTAT 58.465 34.615 0.00 0.0 0.00 2.12
2328 2421 8.674173 TCATATAATTTCCCCTTTGGCACTATA 58.326 33.333 0.00 0.0 0.00 1.31
2587 2962 5.117406 ACATGGATCCTCTTACCTTTTCC 57.883 43.478 14.23 0.0 0.00 3.13
2609 2984 4.142049 CCTCTCAGTTCATAGTTGGGACTC 60.142 50.000 0.00 0.0 37.33 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 6.150307 TGCATATAACGGACAAGAAAACATGT 59.850 34.615 0.00 0.0 0.00 3.21
11 12 6.751514 TGCATATAACGGACAAGAAAACAT 57.248 33.333 0.00 0.0 0.00 2.71
86 87 2.436173 CCCCCTCTTGAGTTCATAGACC 59.564 54.545 0.00 0.0 0.00 3.85
368 374 1.925255 TGAAGGAATCTCCCATGCCTT 59.075 47.619 0.00 0.0 41.39 4.35
705 713 1.402968 CACACAAGGCATATGGAGTGC 59.597 52.381 4.56 0.0 41.78 4.40
726 734 1.218316 CTCACGGCCTTGGTACTCC 59.782 63.158 9.71 0.0 0.00 3.85
739 747 0.176680 CCCCTCTGATTGGTCTCACG 59.823 60.000 0.00 0.0 0.00 4.35
988 1057 3.243501 GGTGTCTGTGTAGTTACGTTCCA 60.244 47.826 0.00 0.0 0.00 3.53
1124 1194 1.679977 CTGGCCCACCACCTTGATG 60.680 63.158 0.00 0.0 42.67 3.07
1165 1235 0.526524 GAGCTTGTCGGTCATCCTCG 60.527 60.000 0.00 0.0 39.89 4.63
1191 1261 1.049402 TGGTACCACACGTCCATGAA 58.951 50.000 11.60 0.0 0.00 2.57
1810 1885 6.518208 ACAAAAGCTGTTTGGTAAACACTA 57.482 33.333 18.96 0.0 45.79 2.74
1844 1919 7.593644 GTCGTAGAACAAATAAAAAGGTGCATT 59.406 33.333 0.00 0.0 39.69 3.56
1845 1920 7.040686 AGTCGTAGAACAAATAAAAAGGTGCAT 60.041 33.333 0.00 0.0 39.69 3.96
2587 2962 4.439426 CGAGTCCCAACTATGAACTGAGAG 60.439 50.000 0.00 0.0 35.28 3.20
2609 2984 2.098117 GGCAAATCTCAAATCAGACCCG 59.902 50.000 0.00 0.0 0.00 5.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.