Multiple sequence alignment - TraesCS1D01G326700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G326700 chr1D 100.000 2608 0 0 1 2608 419200480 419203087 0.000000e+00 4817.0
1 TraesCS1D01G326700 chr1D 97.776 2608 54 3 1 2608 486229700 486232303 0.000000e+00 4492.0
2 TraesCS1D01G326700 chr6D 98.006 2608 47 1 1 2608 6286928 6284326 0.000000e+00 4523.0
3 TraesCS1D01G326700 chr6D 97.702 2611 56 3 1 2608 2771339 2773948 0.000000e+00 4486.0
4 TraesCS1D01G326700 chr3D 97.814 2608 46 4 1 2608 2046092 2043496 0.000000e+00 4490.0
5 TraesCS1D01G326700 chr3D 97.777 2609 40 7 1 2608 166983450 166986041 0.000000e+00 4481.0
6 TraesCS1D01G326700 chr3D 97.774 2606 45 4 3 2605 360365421 360368016 0.000000e+00 4479.0
7 TraesCS1D01G326700 chr7D 97.774 2606 43 8 3 2608 460098830 460101420 0.000000e+00 4477.0
8 TraesCS1D01G326700 chr7D 97.826 46 1 0 1 46 39609257 39609212 2.150000e-11 80.5
9 TraesCS1D01G326700 chr5D 97.701 2610 45 9 1 2608 532625867 532628463 0.000000e+00 4473.0
10 TraesCS1D01G326700 chr2D 97.726 2594 54 2 19 2608 612830259 612827667 0.000000e+00 4458.0
11 TraesCS1D01G326700 chr7B 92.188 128 8 2 43 170 987502 987627 2.060000e-41 180.0
12 TraesCS1D01G326700 chr5A 98.462 65 1 0 2 66 601010475 601010411 5.900000e-22 115.0
13 TraesCS1D01G326700 chr5B 100.000 37 0 0 1 37 127784978 127785014 4.660000e-08 69.4
14 TraesCS1D01G326700 chr6B 100.000 35 0 0 1 35 37739627 37739593 6.020000e-07 65.8
15 TraesCS1D01G326700 chr6B 100.000 35 0 0 1 35 689047617 689047651 6.020000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G326700 chr1D 419200480 419203087 2607 False 4817 4817 100.000 1 2608 1 chr1D.!!$F1 2607
1 TraesCS1D01G326700 chr1D 486229700 486232303 2603 False 4492 4492 97.776 1 2608 1 chr1D.!!$F2 2607
2 TraesCS1D01G326700 chr6D 6284326 6286928 2602 True 4523 4523 98.006 1 2608 1 chr6D.!!$R1 2607
3 TraesCS1D01G326700 chr6D 2771339 2773948 2609 False 4486 4486 97.702 1 2608 1 chr6D.!!$F1 2607
4 TraesCS1D01G326700 chr3D 2043496 2046092 2596 True 4490 4490 97.814 1 2608 1 chr3D.!!$R1 2607
5 TraesCS1D01G326700 chr3D 166983450 166986041 2591 False 4481 4481 97.777 1 2608 1 chr3D.!!$F1 2607
6 TraesCS1D01G326700 chr3D 360365421 360368016 2595 False 4479 4479 97.774 3 2605 1 chr3D.!!$F2 2602
7 TraesCS1D01G326700 chr7D 460098830 460101420 2590 False 4477 4477 97.774 3 2608 1 chr7D.!!$F1 2605
8 TraesCS1D01G326700 chr5D 532625867 532628463 2596 False 4473 4473 97.701 1 2608 1 chr5D.!!$F1 2607
9 TraesCS1D01G326700 chr2D 612827667 612830259 2592 True 4458 4458 97.726 19 2608 1 chr2D.!!$R1 2589

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
277 285 2.674357 ACGTAACGTTTGGCATGTATCC 59.326 45.455 5.91 0.0 36.35 2.59 F
1371 1382 1.202371 GCACGTTCGGATATGGACAGA 60.202 52.381 0.00 0.0 0.00 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1572 1583 1.705337 CGCCGACATAAGGTTGCCAG 61.705 60.000 0.0 0.0 0.00 4.85 R
2283 2294 2.751259 GTCTTGCTGCCATTCAGATCAA 59.249 45.455 0.0 0.0 45.72 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
83 84 3.680169 TCCCATGACCCCATAGAGAATT 58.320 45.455 0.00 0.00 0.00 2.17
209 216 6.977502 TCACATTGTCCAATTAACACTTTGTG 59.022 34.615 15.44 15.44 39.75 3.33
277 285 2.674357 ACGTAACGTTTGGCATGTATCC 59.326 45.455 5.91 0.00 36.35 2.59
340 349 3.865011 AATTGCGCCAAACATATCACA 57.135 38.095 4.18 0.00 0.00 3.58
592 602 7.342284 CACGGATATATACCTTCCCATTCTACT 59.658 40.741 0.00 0.00 0.00 2.57
1371 1382 1.202371 GCACGTTCGGATATGGACAGA 60.202 52.381 0.00 0.00 0.00 3.41
1511 1522 6.243148 TCAATTTTTCTCCCCCTGTAAGTAC 58.757 40.000 0.00 0.00 0.00 2.73
1640 1651 1.293179 CACAGTCGCCATCCACTCA 59.707 57.895 0.00 0.00 0.00 3.41
1716 1727 6.125029 ACATATCTTCAATTCTCCCCTTGTG 58.875 40.000 0.00 0.00 0.00 3.33
1842 1853 0.178891 AGAGTCCCCAGTCACACCAT 60.179 55.000 0.00 0.00 0.00 3.55
2370 2381 2.103771 CCGAGGATGACATTGATCCAGT 59.896 50.000 7.04 0.00 41.82 4.00
2502 2513 1.903183 GGGTCTTGCTAGAGAGTTGGT 59.097 52.381 0.00 0.00 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
83 84 4.099727 CCACATGGAAACCATTATGCATGA 59.900 41.667 10.16 0.0 42.23 3.07
277 285 4.222124 AGGAATAGTGGCTACTTGGTTG 57.778 45.455 8.46 0.0 38.36 3.77
318 327 4.667262 TGTGATATGTTTGGCGCAATTAC 58.333 39.130 10.83 0.0 0.00 1.89
340 349 7.039644 TGTCAACCCATTTTCGTTGGTAATTAT 60.040 33.333 0.00 0.0 39.84 1.28
559 569 7.093640 TGGGAAGGTATATATCCGTGATTGTAC 60.094 40.741 0.00 0.0 33.90 2.90
592 602 4.910913 TGGTTAGGATAGGGTTGATATGCA 59.089 41.667 0.00 0.0 0.00 3.96
1511 1522 6.475727 CCTTAATATATACAATCGGTGCGAGG 59.524 42.308 0.00 0.0 39.91 4.63
1572 1583 1.705337 CGCCGACATAAGGTTGCCAG 61.705 60.000 0.00 0.0 0.00 4.85
1640 1651 3.430929 GGGTGACTCTATCGCAATGTCTT 60.431 47.826 0.00 0.0 39.82 3.01
1867 1878 2.553028 GCCATCTCAAACCTTCTCACCA 60.553 50.000 0.00 0.0 0.00 4.17
2235 2246 3.760151 TCCTGCAATCAAGAACATTCCTG 59.240 43.478 0.00 0.0 0.00 3.86
2283 2294 2.751259 GTCTTGCTGCCATTCAGATCAA 59.249 45.455 0.00 0.0 45.72 2.57
2370 2381 7.928167 TGCATGTAACATGTAAAATTTGAACCA 59.072 29.630 0.00 0.0 0.00 3.67
2502 2513 5.943416 TGAAGTTGTTCTTGTTCTTTCTCCA 59.057 36.000 0.00 0.0 36.40 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.