Multiple sequence alignment - TraesCS1D01G323700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G323700 chr1D 100.000 3156 0 0 1 3156 416252904 416249749 0 5829
1 TraesCS1D01G323700 chr1D 96.104 3157 119 2 1 3156 469425233 469422080 0 5145
2 TraesCS1D01G323700 chr2D 98.194 3156 54 1 1 3156 634006239 634003087 0 5509
3 TraesCS1D01G323700 chr7D 98.035 3156 58 2 1 3156 32792265 32795416 0 5481
4 TraesCS1D01G323700 chr7D 96.737 3157 98 3 1 3156 520800797 520803949 0 5254
5 TraesCS1D01G323700 chr7D 96.390 3158 109 3 1 3156 244739945 244736791 0 5195
6 TraesCS1D01G323700 chr7D 96.326 3157 111 3 1 3156 272328461 272325309 0 5182
7 TraesCS1D01G323700 chr5D 97.080 3151 84 6 7 3156 459853076 459849933 0 5302
8 TraesCS1D01G323700 chrUn 96.579 3157 103 3 1 3156 79113938 79117090 0 5227
9 TraesCS1D01G323700 chr4D 96.390 3158 107 5 1 3156 488082779 488085931 0 5193


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G323700 chr1D 416249749 416252904 3155 True 5829 5829 100.000 1 3156 1 chr1D.!!$R1 3155
1 TraesCS1D01G323700 chr1D 469422080 469425233 3153 True 5145 5145 96.104 1 3156 1 chr1D.!!$R2 3155
2 TraesCS1D01G323700 chr2D 634003087 634006239 3152 True 5509 5509 98.194 1 3156 1 chr2D.!!$R1 3155
3 TraesCS1D01G323700 chr7D 32792265 32795416 3151 False 5481 5481 98.035 1 3156 1 chr7D.!!$F1 3155
4 TraesCS1D01G323700 chr7D 520800797 520803949 3152 False 5254 5254 96.737 1 3156 1 chr7D.!!$F2 3155
5 TraesCS1D01G323700 chr7D 244736791 244739945 3154 True 5195 5195 96.390 1 3156 1 chr7D.!!$R1 3155
6 TraesCS1D01G323700 chr7D 272325309 272328461 3152 True 5182 5182 96.326 1 3156 1 chr7D.!!$R2 3155
7 TraesCS1D01G323700 chr5D 459849933 459853076 3143 True 5302 5302 97.080 7 3156 1 chr5D.!!$R1 3149
8 TraesCS1D01G323700 chrUn 79113938 79117090 3152 False 5227 5227 96.579 1 3156 1 chrUn.!!$F1 3155
9 TraesCS1D01G323700 chr4D 488082779 488085931 3152 False 5193 5193 96.390 1 3156 1 chr4D.!!$F1 3155

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
870 873 0.391597 CCCTCGGCGGCTTAAATAGA 59.608 55.0 7.21 0.0 0.0 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2714 2721 0.251653 ACTCCGGCTGACTTGGTCTA 60.252 55.0 0.0 0.0 33.15 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 134 0.793861 CCGAAAATCGAGGCGTTTCA 59.206 50.000 0.58 0.0 43.74 2.69
405 407 1.146452 TCTCCGCTACTCCATAGGGA 58.854 55.000 0.00 0.0 44.76 4.20
504 507 3.091545 TGCCCCTTTTTGATCTTAGCTG 58.908 45.455 0.00 0.0 0.00 4.24
555 558 5.518865 AGGACCCATTTTACATGCAAGTAT 58.481 37.500 2.11 0.0 0.00 2.12
787 790 5.847111 AACTTTCCGGCTTAAAGAAAACT 57.153 34.783 18.21 0.0 37.38 2.66
870 873 0.391597 CCCTCGGCGGCTTAAATAGA 59.608 55.000 7.21 0.0 0.00 1.98
910 913 8.570038 TGTATACCATTAGTCCCCTTCATAAA 57.430 34.615 0.00 0.0 0.00 1.40
1009 1013 0.038166 GACTTTCACCATGCCTCCCA 59.962 55.000 0.00 0.0 0.00 4.37
1010 1014 0.482446 ACTTTCACCATGCCTCCCAA 59.518 50.000 0.00 0.0 0.00 4.12
1011 1015 1.133199 ACTTTCACCATGCCTCCCAAA 60.133 47.619 0.00 0.0 0.00 3.28
1077 1081 3.942829 TGAGACCCTAGCAGATTTTGTG 58.057 45.455 0.00 0.0 0.00 3.33
1107 1111 1.568504 ATCTGCCCAAGAAGGACGTA 58.431 50.000 0.00 0.0 41.22 3.57
1179 1183 2.802719 GGGGAGGTAGTGATTTTTGCA 58.197 47.619 0.00 0.0 0.00 4.08
1464 1468 0.398696 TTTTCCCTTACGCAGAGCCA 59.601 50.000 0.00 0.0 0.00 4.75
1672 1676 2.083774 GCAATGGTCTGAACGGAATCA 58.916 47.619 0.00 0.0 0.00 2.57
1892 1896 2.846532 CAAGACCAACCCAGCCCT 59.153 61.111 0.00 0.0 0.00 5.19
2053 2059 2.625314 GGCCAGAAAAGTGAAGAAAGCT 59.375 45.455 0.00 0.0 0.00 3.74
2063 2069 3.893813 AGTGAAGAAAGCTGCCAAGAAAT 59.106 39.130 0.00 0.0 0.00 2.17
2154 2160 1.630878 AGAGGTAACCCCTGAGCTTTG 59.369 52.381 0.00 0.0 46.51 2.77
2227 2233 0.984230 ATTGACAGGATGACACCGGT 59.016 50.000 0.00 0.0 41.16 5.28
2737 2744 3.241530 AAGTCAGCCGGAGTGCCA 61.242 61.111 5.05 0.0 0.00 4.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 134 1.837090 GGCGTGGTTATCTCCCCAT 59.163 57.895 0.00 0.00 32.32 4.00
405 407 1.142465 TCGAGCCCTAGTACGGATCTT 59.858 52.381 2.60 0.00 33.49 2.40
504 507 2.884894 ACCGCAGTAAGCCTATACAC 57.115 50.000 0.00 0.00 41.38 2.90
555 558 7.680730 AGGTTCTTATGCAGTAAAAAGAGAGA 58.319 34.615 0.00 0.00 30.19 3.10
787 790 2.287909 GCCGGAAATTTTATGGCGCATA 60.288 45.455 10.83 2.29 35.77 3.14
870 873 5.676552 TGGTATACATTTAAGTGCATCGGT 58.323 37.500 5.01 0.00 0.00 4.69
910 913 1.990160 TTCAAGGTCAAGGTGGCGGT 61.990 55.000 0.00 0.00 0.00 5.68
1010 1014 4.344968 AGTTGCAAGTAATGGGAGCTTTTT 59.655 37.500 4.57 0.00 0.00 1.94
1011 1015 3.897505 AGTTGCAAGTAATGGGAGCTTTT 59.102 39.130 4.57 0.00 0.00 2.27
1077 1081 1.048601 TGGGCAGATATCCGGACTTC 58.951 55.000 6.12 6.86 0.00 3.01
1107 1111 1.615424 AGGGGCACGGTAGGACATT 60.615 57.895 0.00 0.00 0.00 2.71
1179 1183 1.986413 GCCCCGGCTCATATGATCT 59.014 57.895 5.72 0.00 38.26 2.75
1464 1468 4.938756 TCCTTGGGGTGGCTGGGT 62.939 66.667 0.00 0.00 0.00 4.51
1672 1676 0.999712 ATCCAGACCCGGACCAAATT 59.000 50.000 0.73 0.00 38.07 1.82
1944 1948 7.521529 TGATGATTTCTTCAAACGATTCAGAC 58.478 34.615 0.00 0.00 38.03 3.51
2041 2047 2.645838 TCTTGGCAGCTTTCTTCACT 57.354 45.000 0.00 0.00 0.00 3.41
2053 2059 2.362375 GGGGCGGATTTCTTGGCA 60.362 61.111 0.00 0.00 0.00 4.92
2154 2160 5.886960 ACAGTGAATACAGCAAGGATTTC 57.113 39.130 0.00 0.00 0.00 2.17
2710 2717 1.002087 CCGGCTGACTTGGTCTACTTT 59.998 52.381 0.00 0.00 33.15 2.66
2714 2721 0.251653 ACTCCGGCTGACTTGGTCTA 60.252 55.000 0.00 0.00 33.15 2.59
2737 2744 2.236395 CACCTCCGGTTCAGGTAAATCT 59.764 50.000 12.72 0.00 42.85 2.40
2936 2943 1.079621 TAGGTCTCCCCGGCTCAAA 59.920 57.895 0.00 0.00 38.74 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.