Multiple sequence alignment - TraesCS1D01G322800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G322800 chr1D 100.000 2481 0 0 1 2481 415596483 415598963 0 4582
1 TraesCS1D01G322800 chr5D 98.710 2481 32 0 1 2481 127940079 127937599 0 4405
2 TraesCS1D01G322800 chr6D 98.549 2481 36 0 1 2481 450189415 450186935 0 4383
3 TraesCS1D01G322800 chr7D 98.468 2480 38 0 2 2481 340173556 340176035 0 4370
4 TraesCS1D01G322800 chr7D 97.374 1866 46 3 1 1865 530741018 530739155 0 3171
5 TraesCS1D01G322800 chr7B 96.686 1539 49 2 1 1538 593350336 593348799 0 2558
6 TraesCS1D01G322800 chr4D 92.005 1751 116 11 68 1810 85851885 85850151 0 2436
7 TraesCS1D01G322800 chr5A 95.269 1522 68 4 964 2481 13088188 13086667 0 2409
8 TraesCS1D01G322800 chr2D 92.818 1643 113 5 172 1810 29096340 29094699 0 2375
9 TraesCS1D01G322800 chr2B 94.809 1522 75 4 964 2481 788173795 788175316 0 2370
10 TraesCS1D01G322800 chr2B 92.338 1501 100 12 68 1560 134342241 134343734 0 2121
11 TraesCS1D01G322800 chrUn 94.350 1522 77 7 964 2481 284057379 284055863 0 2326
12 TraesCS1D01G322800 chrUn 94.350 1522 77 7 964 2481 284067909 284069425 0 2326
13 TraesCS1D01G322800 chr3B 91.614 1276 88 11 1 1272 775659564 775658304 0 1746


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G322800 chr1D 415596483 415598963 2480 False 4582 4582 100.000 1 2481 1 chr1D.!!$F1 2480
1 TraesCS1D01G322800 chr5D 127937599 127940079 2480 True 4405 4405 98.710 1 2481 1 chr5D.!!$R1 2480
2 TraesCS1D01G322800 chr6D 450186935 450189415 2480 True 4383 4383 98.549 1 2481 1 chr6D.!!$R1 2480
3 TraesCS1D01G322800 chr7D 340173556 340176035 2479 False 4370 4370 98.468 2 2481 1 chr7D.!!$F1 2479
4 TraesCS1D01G322800 chr7D 530739155 530741018 1863 True 3171 3171 97.374 1 1865 1 chr7D.!!$R1 1864
5 TraesCS1D01G322800 chr7B 593348799 593350336 1537 True 2558 2558 96.686 1 1538 1 chr7B.!!$R1 1537
6 TraesCS1D01G322800 chr4D 85850151 85851885 1734 True 2436 2436 92.005 68 1810 1 chr4D.!!$R1 1742
7 TraesCS1D01G322800 chr5A 13086667 13088188 1521 True 2409 2409 95.269 964 2481 1 chr5A.!!$R1 1517
8 TraesCS1D01G322800 chr2D 29094699 29096340 1641 True 2375 2375 92.818 172 1810 1 chr2D.!!$R1 1638
9 TraesCS1D01G322800 chr2B 788173795 788175316 1521 False 2370 2370 94.809 964 2481 1 chr2B.!!$F2 1517
10 TraesCS1D01G322800 chr2B 134342241 134343734 1493 False 2121 2121 92.338 68 1560 1 chr2B.!!$F1 1492
11 TraesCS1D01G322800 chrUn 284055863 284057379 1516 True 2326 2326 94.350 964 2481 1 chrUn.!!$R1 1517
12 TraesCS1D01G322800 chrUn 284067909 284069425 1516 False 2326 2326 94.350 964 2481 1 chrUn.!!$F1 1517
13 TraesCS1D01G322800 chr3B 775658304 775659564 1260 True 1746 1746 91.614 1 1272 1 chr3B.!!$R1 1271

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
675 679 2.526888 TCTAATCTCCCACCTCACGT 57.473 50.0 0.0 0.0 0.0 4.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1854 1871 1.601663 GCAAAATAGGTTGTGCACGCA 60.602 47.619 13.13 0.0 36.97 5.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
247 250 3.056536 GTGTCTGATGGAGCAGTTGTAGA 60.057 47.826 0.00 0.0 37.20 2.59
393 397 8.189119 TGACCATCCAGCTTTTAATTTTAGTT 57.811 30.769 0.00 0.0 0.00 2.24
629 633 2.768698 CCATCAGTGGCAATTGCAAAA 58.231 42.857 30.32 13.6 44.36 2.44
675 679 2.526888 TCTAATCTCCCACCTCACGT 57.473 50.000 0.00 0.0 0.00 4.49
774 779 7.505258 TGCCTACACAATGCTAGTAATAATCA 58.495 34.615 0.00 0.0 0.00 2.57
1047 1055 1.073199 CAAGGGCTTTGACGGAGGT 59.927 57.895 2.75 0.0 39.21 3.85
1077 1085 2.031012 CCGACCTTGCTGCTCACA 59.969 61.111 0.00 0.0 0.00 3.58
1346 1357 1.847737 TGTTAACCACCCAACAGACCT 59.152 47.619 2.48 0.0 31.29 3.85
1854 1871 8.043710 CCTATTTTAGTCCTCTCTGTCATGTTT 58.956 37.037 0.00 0.0 0.00 2.83
1894 1911 4.015764 TGCCAATGAGCAAGTTTAGCATA 58.984 39.130 0.00 0.0 40.56 3.14
1965 1982 6.047870 CGTCCTAGCTGTCTAGTTAGTAAGA 58.952 44.000 0.00 0.0 40.51 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
629 633 7.733969 AGATACTGACATATCAAGCACAGAAT 58.266 34.615 0.00 0.00 34.50 2.40
675 679 5.183904 GCTCCTTTCCTCTTTAATTTCAGCA 59.816 40.000 0.00 0.00 0.00 4.41
774 779 1.473258 ATGGCGCCATTGTACACAAT 58.527 45.000 36.10 11.49 46.62 2.71
1020 1027 2.966732 AAAGCCCTTGATCCCGCGA 61.967 57.895 8.23 0.00 0.00 5.87
1077 1085 1.081108 GAGCACGTCGCACTCTTCT 60.081 57.895 11.58 0.00 46.13 2.85
1265 1276 9.454859 CATTGTCCCTAGTAGAAGAAGAAAATT 57.545 33.333 0.00 0.00 0.00 1.82
1688 1705 5.532032 CCAAATTGAGCCAATTCTGGTTTTT 59.468 36.000 19.40 4.71 42.32 1.94
1854 1871 1.601663 GCAAAATAGGTTGTGCACGCA 60.602 47.619 13.13 0.00 36.97 5.24
1894 1911 7.341256 AGCATAAGATCATGGAAGAACAAACAT 59.659 33.333 0.00 0.00 0.00 2.71
2238 2255 4.571580 CACAAGAAAAATTTCAGGCTGCAA 59.428 37.500 10.34 5.68 39.61 4.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.