Multiple sequence alignment - TraesCS1D01G316000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G316000 chr1D 100.000 2677 0 0 1 2677 411211000 411208324 0 4944
1 TraesCS1D01G316000 chr1D 97.805 2688 46 7 1 2677 38760768 38758083 0 4636
2 TraesCS1D01G316000 chr1D 97.179 2694 57 8 1 2677 486227000 486224309 0 4536
3 TraesCS1D01G316000 chr1D 97.577 2641 57 5 41 2677 419191526 419188889 0 4516
4 TraesCS1D01G316000 chr6D 98.400 2688 30 5 1 2677 465378860 465381545 0 4713
5 TraesCS1D01G316000 chr6D 97.834 2678 53 3 1 2677 306332898 306335571 0 4619
6 TraesCS1D01G316000 chr4D 98.174 2683 42 6 1 2677 460973922 460971241 0 4676
7 TraesCS1D01G316000 chr2D 97.954 2688 42 6 1 2677 191218404 191215719 0 4647
8 TraesCS1D01G316000 chr5D 97.918 2690 42 6 1 2677 8248845 8246157 0 4645
9 TraesCS1D01G316000 chr3D 97.134 2687 61 6 1 2677 54666004 54668684 0 4521


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G316000 chr1D 411208324 411211000 2676 True 4944 4944 100.000 1 2677 1 chr1D.!!$R2 2676
1 TraesCS1D01G316000 chr1D 38758083 38760768 2685 True 4636 4636 97.805 1 2677 1 chr1D.!!$R1 2676
2 TraesCS1D01G316000 chr1D 486224309 486227000 2691 True 4536 4536 97.179 1 2677 1 chr1D.!!$R4 2676
3 TraesCS1D01G316000 chr1D 419188889 419191526 2637 True 4516 4516 97.577 41 2677 1 chr1D.!!$R3 2636
4 TraesCS1D01G316000 chr6D 465378860 465381545 2685 False 4713 4713 98.400 1 2677 1 chr6D.!!$F2 2676
5 TraesCS1D01G316000 chr6D 306332898 306335571 2673 False 4619 4619 97.834 1 2677 1 chr6D.!!$F1 2676
6 TraesCS1D01G316000 chr4D 460971241 460973922 2681 True 4676 4676 98.174 1 2677 1 chr4D.!!$R1 2676
7 TraesCS1D01G316000 chr2D 191215719 191218404 2685 True 4647 4647 97.954 1 2677 1 chr2D.!!$R1 2676
8 TraesCS1D01G316000 chr5D 8246157 8248845 2688 True 4645 4645 97.918 1 2677 1 chr5D.!!$R1 2676
9 TraesCS1D01G316000 chr3D 54666004 54668684 2680 False 4521 4521 97.134 1 2677 1 chr3D.!!$F1 2676

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
946 991 1.943968 GCATGTAACAGGAACTCGGCA 60.944 52.381 0.0 0.0 34.6 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2288 2338 6.323996 TGACATACATGTAGTTCCCTCCTTAG 59.676 42.308 11.91 0.0 41.95 2.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
543 588 3.900892 CGCCGCCATCTACTCGGT 61.901 66.667 1.83 0.0 44.58 4.69
784 829 4.082571 AGCCGGATTTTATCATTGCATAGC 60.083 41.667 5.05 0.0 0.00 2.97
946 991 1.943968 GCATGTAACAGGAACTCGGCA 60.944 52.381 0.00 0.0 34.60 5.69
1011 1056 6.267070 GTTCGGAAAAACCATGAAACTGTTA 58.733 36.000 0.00 0.0 38.90 2.41
1236 1282 4.326212 GGGGAGGATATAGAGCCACATCTA 60.326 50.000 0.00 0.0 36.27 1.98
1632 1678 8.309656 TGCATATCTCTATGGTGATGAACTAAG 58.690 37.037 4.09 0.0 36.11 2.18
1738 1785 1.412387 GACGAAACGACGGCTACTTT 58.588 50.000 0.00 0.0 38.37 2.66
2079 2129 7.276658 TCATTTAGCTATTGTTATCAACGGGA 58.723 34.615 0.00 0.0 36.33 5.14
2131 2181 1.199789 GTTGAAGCCATGAATGCACGA 59.800 47.619 0.00 0.0 0.00 4.35
2288 2338 2.350804 GCCGAGGACGAAATTAAAGACC 59.649 50.000 0.00 0.0 42.66 3.85
2328 2378 7.121020 ACATGTATGTCATACTGTGCATTTTGA 59.879 33.333 20.91 0.2 35.87 2.69
2371 2421 6.867816 TCCTTCATGTTCATTATTGTTTGCAC 59.132 34.615 0.00 0.0 0.00 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
543 588 1.176619 TTCTCTCGAAGACGGTGCCA 61.177 55.000 0.00 0.0 40.21 4.92
784 829 3.005050 TCTGAAACTGAAATTGCTGGCTG 59.995 43.478 0.00 0.0 0.00 4.85
795 840 9.567776 TTATGAAGGTTTGTATCTGAAACTGAA 57.432 29.630 0.00 0.0 34.36 3.02
946 991 8.353423 ACTAACTTCATATGACCATGCTTTTT 57.647 30.769 4.48 0.0 0.00 1.94
1011 1056 4.787551 TGTACTTTTTGTGGTCTGGTGAT 58.212 39.130 0.00 0.0 0.00 3.06
1236 1282 2.571212 TCTGTGTCGGTTTGCATTTCT 58.429 42.857 0.00 0.0 0.00 2.52
1615 1661 9.383519 ACACAATAACTTAGTTCATCACCATAG 57.616 33.333 0.00 0.0 0.00 2.23
1632 1678 7.558604 TCCCAGTACCAATACTACACAATAAC 58.441 38.462 0.00 0.0 39.80 1.89
1674 1720 5.221722 GGGGTCTAGAAGCATACATCAATCA 60.222 44.000 0.00 0.0 0.00 2.57
1738 1785 3.497297 TTGTCGTAAGCATCGCTTCTA 57.503 42.857 4.16 0.0 46.77 2.10
2131 2181 7.718753 CCTACCTTCTTTTCATGATCAGCTAAT 59.281 37.037 0.09 0.0 0.00 1.73
2288 2338 6.323996 TGACATACATGTAGTTCCCTCCTTAG 59.676 42.308 11.91 0.0 41.95 2.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.