Multiple sequence alignment - TraesCS1D01G310500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G310500 chr1D 100.000 2590 0 0 1 2590 406564659 406567248 0.000000e+00 4783
1 TraesCS1D01G310500 chr6B 95.308 1982 57 11 641 2590 668925247 668927224 0.000000e+00 3112
2 TraesCS1D01G310500 chr6B 94.710 1985 68 12 640 2590 703850159 703852140 0.000000e+00 3049
3 TraesCS1D01G310500 chr7A 94.705 1983 65 16 645 2590 9746164 9744185 0.000000e+00 3044
4 TraesCS1D01G310500 chr7A 97.722 1668 35 3 923 2589 709016561 709014896 0.000000e+00 2867
5 TraesCS1D01G310500 chr7A 97.302 1668 41 4 923 2589 708964813 708963149 0.000000e+00 2828
6 TraesCS1D01G310500 chr7A 93.452 336 20 2 645 979 709016894 709016560 4.980000e-137 497
7 TraesCS1D01G310500 chr7A 93.155 336 21 2 645 979 708965146 708964812 2.320000e-135 492
8 TraesCS1D01G310500 chr4A 96.896 1643 48 2 951 2590 660222485 660224127 0.000000e+00 2748
9 TraesCS1D01G310500 chr1B 89.050 2000 126 34 644 2590 599266301 599268260 0.000000e+00 2394
10 TraesCS1D01G310500 chr1B 89.045 712 22 17 646 1325 283872689 283872002 0.000000e+00 832
11 TraesCS1D01G310500 chr2D 97.603 1377 31 2 1215 2590 474438182 474436807 0.000000e+00 2359
12 TraesCS1D01G310500 chr2D 93.837 649 36 4 1 647 49637073 49636427 0.000000e+00 974
13 TraesCS1D01G310500 chr2D 93.972 647 34 5 3 647 525337573 525338216 0.000000e+00 974
14 TraesCS1D01G310500 chr2D 90.143 558 26 3 647 1176 474438744 474438188 0.000000e+00 699
15 TraesCS1D01G310500 chr5B 95.073 1441 64 7 647 2084 6645211 6643775 0.000000e+00 2261
16 TraesCS1D01G310500 chr5B 92.769 650 43 4 1 647 403205897 403206545 0.000000e+00 937
17 TraesCS1D01G310500 chr2B 95.873 1163 40 3 923 2084 712755960 712754805 0.000000e+00 1875
18 TraesCS1D01G310500 chr4D 92.963 739 37 7 1853 2590 445489784 445490508 0.000000e+00 1062
19 TraesCS1D01G310500 chr3D 96.291 647 22 2 1 646 428160536 428159891 0.000000e+00 1061
20 TraesCS1D01G310500 chr3D 96.285 646 22 2 2 646 444888001 444887357 0.000000e+00 1059
21 TraesCS1D01G310500 chr3D 93.498 646 39 3 3 647 275751174 275750531 0.000000e+00 957
22 TraesCS1D01G310500 chr3D 92.683 656 42 5 1 652 100283170 100283823 0.000000e+00 941
23 TraesCS1D01G310500 chr3D 92.530 656 43 6 3 656 211981024 211980373 0.000000e+00 935
24 TraesCS1D01G310500 chr3D 95.382 563 25 1 2029 2590 354002655 354002093 0.000000e+00 894
25 TraesCS1D01G310500 chr7D 96.136 647 22 3 1 646 123179412 123180056 0.000000e+00 1053
26 TraesCS1D01G310500 chr7D 95.827 647 25 2 1 646 417903642 417904287 0.000000e+00 1044
27 TraesCS1D01G310500 chr7D 95.672 647 25 3 1 646 277053108 277053752 0.000000e+00 1037
28 TraesCS1D01G310500 chr7D 95.518 647 26 3 1 646 24691650 24691006 0.000000e+00 1031
29 TraesCS1D01G310500 chr7D 93.140 656 39 6 2 656 316892924 316893574 0.000000e+00 957
30 TraesCS1D01G310500 chr7D 93.488 645 37 5 2 644 153940585 153941226 0.000000e+00 953
31 TraesCS1D01G310500 chr7D 93.210 648 38 5 1 644 544123777 544124422 0.000000e+00 948


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G310500 chr1D 406564659 406567248 2589 False 4783 4783 100.0000 1 2590 1 chr1D.!!$F1 2589
1 TraesCS1D01G310500 chr6B 668925247 668927224 1977 False 3112 3112 95.3080 641 2590 1 chr6B.!!$F1 1949
2 TraesCS1D01G310500 chr6B 703850159 703852140 1981 False 3049 3049 94.7100 640 2590 1 chr6B.!!$F2 1950
3 TraesCS1D01G310500 chr7A 9744185 9746164 1979 True 3044 3044 94.7050 645 2590 1 chr7A.!!$R1 1945
4 TraesCS1D01G310500 chr7A 709014896 709016894 1998 True 1682 2867 95.5870 645 2589 2 chr7A.!!$R3 1944
5 TraesCS1D01G310500 chr7A 708963149 708965146 1997 True 1660 2828 95.2285 645 2589 2 chr7A.!!$R2 1944
6 TraesCS1D01G310500 chr4A 660222485 660224127 1642 False 2748 2748 96.8960 951 2590 1 chr4A.!!$F1 1639
7 TraesCS1D01G310500 chr1B 599266301 599268260 1959 False 2394 2394 89.0500 644 2590 1 chr1B.!!$F1 1946
8 TraesCS1D01G310500 chr1B 283872002 283872689 687 True 832 832 89.0450 646 1325 1 chr1B.!!$R1 679
9 TraesCS1D01G310500 chr2D 474436807 474438744 1937 True 1529 2359 93.8730 647 2590 2 chr2D.!!$R2 1943
10 TraesCS1D01G310500 chr2D 49636427 49637073 646 True 974 974 93.8370 1 647 1 chr2D.!!$R1 646
11 TraesCS1D01G310500 chr2D 525337573 525338216 643 False 974 974 93.9720 3 647 1 chr2D.!!$F1 644
12 TraesCS1D01G310500 chr5B 6643775 6645211 1436 True 2261 2261 95.0730 647 2084 1 chr5B.!!$R1 1437
13 TraesCS1D01G310500 chr5B 403205897 403206545 648 False 937 937 92.7690 1 647 1 chr5B.!!$F1 646
14 TraesCS1D01G310500 chr2B 712754805 712755960 1155 True 1875 1875 95.8730 923 2084 1 chr2B.!!$R1 1161
15 TraesCS1D01G310500 chr4D 445489784 445490508 724 False 1062 1062 92.9630 1853 2590 1 chr4D.!!$F1 737
16 TraesCS1D01G310500 chr3D 428159891 428160536 645 True 1061 1061 96.2910 1 646 1 chr3D.!!$R4 645
17 TraesCS1D01G310500 chr3D 444887357 444888001 644 True 1059 1059 96.2850 2 646 1 chr3D.!!$R5 644
18 TraesCS1D01G310500 chr3D 275750531 275751174 643 True 957 957 93.4980 3 647 1 chr3D.!!$R2 644
19 TraesCS1D01G310500 chr3D 100283170 100283823 653 False 941 941 92.6830 1 652 1 chr3D.!!$F1 651
20 TraesCS1D01G310500 chr3D 211980373 211981024 651 True 935 935 92.5300 3 656 1 chr3D.!!$R1 653
21 TraesCS1D01G310500 chr3D 354002093 354002655 562 True 894 894 95.3820 2029 2590 1 chr3D.!!$R3 561
22 TraesCS1D01G310500 chr7D 123179412 123180056 644 False 1053 1053 96.1360 1 646 1 chr7D.!!$F1 645
23 TraesCS1D01G310500 chr7D 417903642 417904287 645 False 1044 1044 95.8270 1 646 1 chr7D.!!$F5 645
24 TraesCS1D01G310500 chr7D 277053108 277053752 644 False 1037 1037 95.6720 1 646 1 chr7D.!!$F3 645
25 TraesCS1D01G310500 chr7D 24691006 24691650 644 True 1031 1031 95.5180 1 646 1 chr7D.!!$R1 645
26 TraesCS1D01G310500 chr7D 316892924 316893574 650 False 957 957 93.1400 2 656 1 chr7D.!!$F4 654
27 TraesCS1D01G310500 chr7D 153940585 153941226 641 False 953 953 93.4880 2 644 1 chr7D.!!$F2 642
28 TraesCS1D01G310500 chr7D 544123777 544124422 645 False 948 948 93.2100 1 644 1 chr7D.!!$F6 643

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
348 354 2.303175 TGGAAAATATTAGCCACCCGC 58.697 47.619 5.36 0.0 37.98 6.13 F
869 883 2.981350 GCGGGAGGGCGTTTTTGA 60.981 61.111 0.00 0.0 0.00 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1386 1544 5.819991 AGTTGCAATCCTTCTCCTTTCATA 58.180 37.500 0.59 0.0 0.0 2.15 R
2544 2769 1.202290 GCTGAGAAGAAGAGAGAGGCG 60.202 57.143 0.00 0.0 0.0 5.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 2.613133 CCCACCAACGAAAACGACTTAA 59.387 45.455 0.00 0.00 0.00 1.85
118 121 6.530181 GCGGTTCCCAAATAGAAAATAAAGTG 59.470 38.462 0.00 0.00 0.00 3.16
152 156 6.381498 TCCACCATACTTTCACTTTCCATA 57.619 37.500 0.00 0.00 0.00 2.74
249 255 3.571828 TCATTTTTGCATTTCGGGACTGA 59.428 39.130 0.00 0.00 0.00 3.41
268 274 4.082125 CTGAGCATCCCTAAAACCTTTGT 58.918 43.478 0.00 0.00 0.00 2.83
348 354 2.303175 TGGAAAATATTAGCCACCCGC 58.697 47.619 5.36 0.00 37.98 6.13
472 480 9.945904 CATATAGGTAGATATAGCGGACTCATA 57.054 37.037 0.00 0.00 0.00 2.15
492 500 7.015195 ACTCATATGGCAAAACTGGTTTAAAGT 59.985 33.333 2.13 0.00 31.63 2.66
713 725 3.188159 TGGTCACTGTACACAAGAACC 57.812 47.619 0.00 0.00 0.00 3.62
783 795 4.619140 GCCGTAGACCGCGCGTAT 62.619 66.667 29.95 17.01 34.38 3.06
869 883 2.981350 GCGGGAGGGCGTTTTTGA 60.981 61.111 0.00 0.00 0.00 2.69
1385 1543 3.712218 GGGAAGAACTCATTAGGGCTAGT 59.288 47.826 0.00 0.00 0.00 2.57
1386 1544 4.164413 GGGAAGAACTCATTAGGGCTAGTT 59.836 45.833 0.00 0.00 34.96 2.24
1471 1629 3.118519 TCTCTGCAGCAGAATATGAGCAA 60.119 43.478 25.35 0.00 40.18 3.91
1891 2104 9.844790 TTTCTGACATGATAATTGTGAAATGAC 57.155 29.630 0.00 0.00 0.00 3.06
2094 2309 9.875708 AGAGTACCATAAGATCTTGAGATAACT 57.124 33.333 18.47 13.11 34.37 2.24
2544 2769 1.339438 TGATCCTTCTTCTGTGCAGCC 60.339 52.381 0.00 0.00 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 3.251004 GCATGGAAAGTGTTCGAAACTCT 59.749 43.478 0.00 0.0 36.85 3.24
118 121 8.027189 GTGAAAGTATGGTGGAAAAAGGAATAC 58.973 37.037 0.00 0.0 0.00 1.89
249 255 4.388577 AGACAAAGGTTTTAGGGATGCT 57.611 40.909 0.00 0.0 0.00 3.79
308 314 3.249320 CCATGCTGGATGTGTTATTCTCG 59.751 47.826 8.37 0.0 40.96 4.04
463 471 2.355756 CCAGTTTTGCCATATGAGTCCG 59.644 50.000 3.65 0.0 0.00 4.79
599 609 7.283354 TGGTGCATTATTCGGTGTTAATTATGA 59.717 33.333 0.00 0.0 29.18 2.15
713 725 0.669318 ACAGTGACCGTATTGCGTGG 60.669 55.000 0.00 0.0 39.32 4.94
783 795 1.686052 GGACTGGTCAAATTTGTGGCA 59.314 47.619 17.47 0.0 0.00 4.92
824 838 6.964464 TGGGCACTTTAACATAAATCCTCTA 58.036 36.000 0.00 0.0 0.00 2.43
877 893 8.053355 AGAATTGGGGATTTCTATCTAAACGTT 58.947 33.333 0.00 0.0 0.00 3.99
878 894 7.574607 AGAATTGGGGATTTCTATCTAAACGT 58.425 34.615 0.00 0.0 0.00 3.99
1385 1543 6.248433 AGTTGCAATCCTTCTCCTTTCATAA 58.752 36.000 0.59 0.0 0.00 1.90
1386 1544 5.819991 AGTTGCAATCCTTCTCCTTTCATA 58.180 37.500 0.59 0.0 0.00 2.15
2094 2309 8.934023 AAAATATGACTGTGTTTCCCTTTCTA 57.066 30.769 0.00 0.0 0.00 2.10
2544 2769 1.202290 GCTGAGAAGAAGAGAGAGGCG 60.202 57.143 0.00 0.0 0.00 5.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.