Multiple sequence alignment - TraesCS1D01G304200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G304200 chr1D 100.000 2978 0 0 1 2978 401922281 401919304 0.000000e+00 5500.0
1 TraesCS1D01G304200 chr1D 99.464 2238 10 2 1 2238 402007497 402005262 0.000000e+00 4065.0
2 TraesCS1D01G304200 chr1D 99.374 2235 13 1 4 2238 402109057 402106824 0.000000e+00 4048.0
3 TraesCS1D01G304200 chr1D 99.180 2194 17 1 46 2238 402052499 402050306 0.000000e+00 3951.0
4 TraesCS1D01G304200 chr1D 93.972 1410 71 5 830 2238 401775169 401773773 0.000000e+00 2121.0
5 TraesCS1D01G304200 chr1D 88.214 280 13 9 899 1158 401700044 401699765 1.720000e-82 316.0
6 TraesCS1D01G304200 chr1D 96.939 98 3 0 2230 2327 402050352 402050255 6.600000e-37 165.0
7 TraesCS1D01G304200 chr1D 96.939 98 3 0 2230 2327 402106870 402106773 6.600000e-37 165.0
8 TraesCS1D01G304200 chr1D 95.918 98 4 0 2230 2327 402005308 402005211 3.070000e-35 159.0
9 TraesCS1D01G304200 chr1D 97.872 47 1 0 2192 2238 401920052 401920006 6.840000e-12 82.4
10 TraesCS1D01G304200 chr1D 97.872 47 1 0 2230 2276 401920090 401920044 6.840000e-12 82.4
11 TraesCS1D01G304200 chr1D 91.071 56 2 2 302 354 250210531 250210476 4.120000e-09 73.1
12 TraesCS1D01G304200 chr1B 90.533 2176 136 31 12 2154 539590535 539588397 0.000000e+00 2813.0
13 TraesCS1D01G304200 chr1B 86.765 68 7 2 554 620 642509309 642509375 1.140000e-09 75.0
14 TraesCS1D01G304200 chr1A 93.902 1640 63 10 604 2238 497585842 497584235 0.000000e+00 2440.0
15 TraesCS1D01G304200 chr1A 92.948 1418 65 13 830 2238 497580598 497579207 0.000000e+00 2032.0
16 TraesCS1D01G304200 chr1A 89.091 275 14 6 899 1158 497537649 497537376 7.960000e-86 327.0
17 TraesCS1D01G304200 chr1A 89.103 156 9 4 354 502 497580965 497580811 1.410000e-43 187.0
18 TraesCS1D01G304200 chr7B 87.611 1122 124 11 997 2115 535506115 535507224 0.000000e+00 1288.0
19 TraesCS1D01G304200 chr7B 84.644 267 40 1 10 276 517606963 517607228 6.330000e-67 265.0
20 TraesCS1D01G304200 chr7D 87.055 1151 124 19 983 2127 506882674 506883805 0.000000e+00 1277.0
21 TraesCS1D01G304200 chr7D 96.951 656 18 2 2322 2977 590516946 590516293 0.000000e+00 1099.0
22 TraesCS1D01G304200 chr7D 96.494 656 22 1 2322 2977 44652271 44651617 0.000000e+00 1083.0
23 TraesCS1D01G304200 chr7D 96.341 656 23 1 2322 2977 379288177 379287523 0.000000e+00 1077.0
24 TraesCS1D01G304200 chr7D 96.189 656 23 2 2322 2977 185382066 185382719 0.000000e+00 1072.0
25 TraesCS1D01G304200 chr7D 87.218 266 33 1 10 275 94741828 94741564 4.820000e-78 302.0
26 TraesCS1D01G304200 chr4D 96.646 656 21 1 2322 2977 456038210 456037556 0.000000e+00 1088.0
27 TraesCS1D01G304200 chr4D 89.655 58 3 2 302 356 64375881 64375938 1.480000e-08 71.3
28 TraesCS1D01G304200 chr5D 96.494 656 21 2 2322 2977 41071982 41071329 0.000000e+00 1083.0
29 TraesCS1D01G304200 chr5D 96.494 656 21 2 2322 2977 41107471 41106818 0.000000e+00 1083.0
30 TraesCS1D01G304200 chr5D 96.478 653 22 1 2325 2977 543539469 543540120 0.000000e+00 1077.0
31 TraesCS1D01G304200 chr5D 96.189 656 24 1 2322 2977 45168980 45168326 0.000000e+00 1072.0
32 TraesCS1D01G304200 chr5D 95.556 45 2 0 553 597 30554223 30554179 4.120000e-09 73.1
33 TraesCS1D01G304200 chr7A 88.060 268 32 0 10 277 680339068 680338801 4.790000e-83 318.0
34 TraesCS1D01G304200 chr7A 84.528 265 35 5 11 274 169017981 169018240 1.060000e-64 257.0
35 TraesCS1D01G304200 chr2A 83.774 265 41 2 10 274 775275980 775275718 1.770000e-62 250.0
36 TraesCS1D01G304200 chr3B 80.892 314 53 6 21 333 390456168 390456475 1.070000e-59 241.0
37 TraesCS1D01G304200 chr6D 91.379 58 2 1 302 356 436797042 436796985 3.180000e-10 76.8
38 TraesCS1D01G304200 chr6D 89.655 58 3 1 303 357 430016643 430016586 1.480000e-08 71.3
39 TraesCS1D01G304200 chr5A 95.652 46 2 0 551 596 47964341 47964386 1.140000e-09 75.0
40 TraesCS1D01G304200 chr2D 75.472 159 33 5 200 354 608523533 608523377 4.120000e-09 73.1
41 TraesCS1D01G304200 chr3A 92.157 51 3 1 554 603 681348477 681348527 1.480000e-08 71.3
42 TraesCS1D01G304200 chr2B 88.889 54 4 2 554 605 67548881 67548934 6.890000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G304200 chr1D 401919304 401922281 2977 True 1888.266667 5500 98.581333 1 2978 3 chr1D.!!$R4 2977
1 TraesCS1D01G304200 chr1D 401773773 401775169 1396 True 2121.000000 2121 93.972000 830 2238 1 chr1D.!!$R3 1408
2 TraesCS1D01G304200 chr1D 402005211 402007497 2286 True 2112.000000 4065 97.691000 1 2327 2 chr1D.!!$R5 2326
3 TraesCS1D01G304200 chr1D 402106773 402109057 2284 True 2106.500000 4048 98.156500 4 2327 2 chr1D.!!$R7 2323
4 TraesCS1D01G304200 chr1D 402050255 402052499 2244 True 2058.000000 3951 98.059500 46 2327 2 chr1D.!!$R6 2281
5 TraesCS1D01G304200 chr1B 539588397 539590535 2138 True 2813.000000 2813 90.533000 12 2154 1 chr1B.!!$R1 2142
6 TraesCS1D01G304200 chr1A 497579207 497585842 6635 True 1553.000000 2440 91.984333 354 2238 3 chr1A.!!$R2 1884
7 TraesCS1D01G304200 chr7B 535506115 535507224 1109 False 1288.000000 1288 87.611000 997 2115 1 chr7B.!!$F2 1118
8 TraesCS1D01G304200 chr7D 506882674 506883805 1131 False 1277.000000 1277 87.055000 983 2127 1 chr7D.!!$F2 1144
9 TraesCS1D01G304200 chr7D 590516293 590516946 653 True 1099.000000 1099 96.951000 2322 2977 1 chr7D.!!$R4 655
10 TraesCS1D01G304200 chr7D 44651617 44652271 654 True 1083.000000 1083 96.494000 2322 2977 1 chr7D.!!$R1 655
11 TraesCS1D01G304200 chr7D 379287523 379288177 654 True 1077.000000 1077 96.341000 2322 2977 1 chr7D.!!$R3 655
12 TraesCS1D01G304200 chr7D 185382066 185382719 653 False 1072.000000 1072 96.189000 2322 2977 1 chr7D.!!$F1 655
13 TraesCS1D01G304200 chr4D 456037556 456038210 654 True 1088.000000 1088 96.646000 2322 2977 1 chr4D.!!$R1 655
14 TraesCS1D01G304200 chr5D 41071329 41071982 653 True 1083.000000 1083 96.494000 2322 2977 1 chr5D.!!$R2 655
15 TraesCS1D01G304200 chr5D 41106818 41107471 653 True 1083.000000 1083 96.494000 2322 2977 1 chr5D.!!$R3 655
16 TraesCS1D01G304200 chr5D 543539469 543540120 651 False 1077.000000 1077 96.478000 2325 2977 1 chr5D.!!$F1 652
17 TraesCS1D01G304200 chr5D 45168326 45168980 654 True 1072.000000 1072 96.189000 2322 2977 1 chr5D.!!$R4 655

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
458 467 4.042934 AGTCAAAGGCCAAACAGGTAGTAT 59.957 41.667 5.01 0.0 40.61 2.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2248 2290 2.838202 TCTTACGATTCAAAGAGGCCCT 59.162 45.455 0.0 0.0 0.0 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
458 467 4.042934 AGTCAAAGGCCAAACAGGTAGTAT 59.957 41.667 5.01 0.00 40.61 2.12
2097 2138 6.324819 ACTTTCATGCATGTACTGTAATTGC 58.675 36.000 25.43 13.43 0.00 3.56
2218 2260 4.289672 TGTTTCTCATCTTTAAGGGCCTCT 59.710 41.667 6.46 0.00 0.00 3.69
2219 2261 5.222130 TGTTTCTCATCTTTAAGGGCCTCTT 60.222 40.000 6.46 7.24 39.40 2.85
2220 2262 5.520748 TTCTCATCTTTAAGGGCCTCTTT 57.479 39.130 6.46 0.00 36.93 2.52
2221 2263 4.848357 TCTCATCTTTAAGGGCCTCTTTG 58.152 43.478 6.46 0.00 36.93 2.77
2222 2264 4.536090 TCTCATCTTTAAGGGCCTCTTTGA 59.464 41.667 6.46 3.96 36.93 2.69
2223 2265 5.014123 TCTCATCTTTAAGGGCCTCTTTGAA 59.986 40.000 6.46 0.00 36.93 2.69
2224 2266 5.831103 TCATCTTTAAGGGCCTCTTTGAAT 58.169 37.500 6.46 0.00 36.93 2.57
2225 2267 5.888161 TCATCTTTAAGGGCCTCTTTGAATC 59.112 40.000 6.46 0.00 36.93 2.52
2226 2268 4.261801 TCTTTAAGGGCCTCTTTGAATCG 58.738 43.478 6.46 0.00 36.93 3.34
2227 2269 3.713826 TTAAGGGCCTCTTTGAATCGT 57.286 42.857 6.46 0.00 36.93 3.73
2228 2270 4.829872 TTAAGGGCCTCTTTGAATCGTA 57.170 40.909 6.46 0.00 36.93 3.43
2229 2271 3.713826 AAGGGCCTCTTTGAATCGTAA 57.286 42.857 6.46 0.00 29.99 3.18
2230 2272 3.268023 AGGGCCTCTTTGAATCGTAAG 57.732 47.619 0.00 0.00 0.00 2.34
2231 2273 3.263425 AAGGGCCTCTTTGAATCGTAAGA 59.737 43.478 6.46 0.00 41.88 2.10
2232 2274 4.080299 AAGGGCCTCTTTGAATCGTAAGAT 60.080 41.667 6.46 0.00 46.93 2.40
2253 2295 8.470657 AAGATTATTTCTCATCTTTAAGGGCC 57.529 34.615 0.00 0.00 36.51 5.80
2254 2296 7.820532 AGATTATTTCTCATCTTTAAGGGCCT 58.179 34.615 0.00 0.00 0.00 5.19
2255 2297 7.941790 AGATTATTTCTCATCTTTAAGGGCCTC 59.058 37.037 6.46 0.00 0.00 4.70
2371 2853 8.308207 GTCCCTATGTAATGAATCTTCTACTCC 58.692 40.741 0.00 0.00 0.00 3.85
2392 3543 7.490000 ACTCCAGTTTAGATAATGTTCTACCG 58.510 38.462 0.00 0.00 0.00 4.02
2455 3613 1.359848 CCGTTCCATTTCTCTGGACG 58.640 55.000 0.00 1.15 44.97 4.79
2553 3711 4.406326 TCATATAGGTTGGAACGGTGCTAA 59.594 41.667 0.00 0.00 0.00 3.09
2568 3726 0.861837 GCTAATTCGAGGCATGGACG 59.138 55.000 0.00 0.00 0.00 4.79
2676 3834 2.651232 GCTCGACGCGCGTATCTT 60.651 61.111 37.91 13.72 41.80 2.40
2680 3838 2.150218 CGACGCGCGTATCTTGTGT 61.150 57.895 37.91 9.99 34.64 3.72
2703 3861 3.838271 GCGATGCGAGGAGGTGGA 61.838 66.667 0.00 0.00 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
325 328 3.890756 TCTATAGCCGTTGGTAAATCCGA 59.109 43.478 0.00 0.00 39.52 4.55
458 467 8.794553 TGTGACCTCTTTGTAAACAAACTTTTA 58.205 29.630 4.19 0.00 40.55 1.52
2227 2269 9.574516 GGCCCTTAAAGATGAGAAATAATCTTA 57.425 33.333 0.00 0.00 38.96 2.10
2228 2270 8.285163 AGGCCCTTAAAGATGAGAAATAATCTT 58.715 33.333 0.00 0.00 38.96 2.40
2229 2271 7.820532 AGGCCCTTAAAGATGAGAAATAATCT 58.179 34.615 0.00 0.00 42.61 2.40
2230 2272 7.941790 AGAGGCCCTTAAAGATGAGAAATAATC 59.058 37.037 0.00 0.00 0.00 1.75
2231 2273 7.820532 AGAGGCCCTTAAAGATGAGAAATAAT 58.179 34.615 0.00 0.00 0.00 1.28
2232 2274 7.213178 AGAGGCCCTTAAAGATGAGAAATAA 57.787 36.000 0.00 0.00 0.00 1.40
2233 2275 6.831664 AGAGGCCCTTAAAGATGAGAAATA 57.168 37.500 0.00 0.00 0.00 1.40
2234 2276 5.723860 AGAGGCCCTTAAAGATGAGAAAT 57.276 39.130 0.00 0.00 0.00 2.17
2235 2277 5.520748 AAGAGGCCCTTAAAGATGAGAAA 57.479 39.130 0.00 0.00 32.24 2.52
2236 2278 5.014123 TCAAAGAGGCCCTTAAAGATGAGAA 59.986 40.000 0.00 0.00 34.00 2.87
2237 2279 4.536090 TCAAAGAGGCCCTTAAAGATGAGA 59.464 41.667 0.00 0.00 34.00 3.27
2238 2280 4.848357 TCAAAGAGGCCCTTAAAGATGAG 58.152 43.478 0.00 0.00 34.00 2.90
2239 2281 4.927267 TCAAAGAGGCCCTTAAAGATGA 57.073 40.909 0.00 0.28 34.00 2.92
2240 2282 5.220931 CGATTCAAAGAGGCCCTTAAAGATG 60.221 44.000 0.00 0.00 34.00 2.90
2241 2283 4.884164 CGATTCAAAGAGGCCCTTAAAGAT 59.116 41.667 0.00 0.00 34.00 2.40
2242 2284 4.261801 CGATTCAAAGAGGCCCTTAAAGA 58.738 43.478 0.00 0.00 34.00 2.52
2243 2285 4.010349 ACGATTCAAAGAGGCCCTTAAAG 58.990 43.478 0.00 0.00 34.00 1.85
2244 2286 4.028993 ACGATTCAAAGAGGCCCTTAAA 57.971 40.909 0.00 1.97 34.00 1.52
2245 2287 3.713826 ACGATTCAAAGAGGCCCTTAA 57.286 42.857 0.00 0.00 34.00 1.85
2246 2288 4.468510 TCTTACGATTCAAAGAGGCCCTTA 59.531 41.667 0.00 0.00 34.00 2.69
2247 2289 3.263425 TCTTACGATTCAAAGAGGCCCTT 59.737 43.478 0.00 0.00 36.47 3.95
2248 2290 2.838202 TCTTACGATTCAAAGAGGCCCT 59.162 45.455 0.00 0.00 0.00 5.19
2249 2291 3.261981 TCTTACGATTCAAAGAGGCCC 57.738 47.619 0.00 0.00 0.00 5.80
2250 2292 7.497925 AATAATCTTACGATTCAAAGAGGCC 57.502 36.000 0.00 0.00 40.28 5.19
2371 2853 8.411683 ACTACCGGTAGAACATTATCTAAACTG 58.588 37.037 41.26 14.76 36.97 3.16
2553 3711 2.684001 TTTACGTCCATGCCTCGAAT 57.316 45.000 0.00 0.00 0.00 3.34
2676 3834 1.078201 CTCGCATCGCAAGCTACACA 61.078 55.000 0.00 0.00 37.18 3.72
2680 3838 1.066422 CTCCTCGCATCGCAAGCTA 59.934 57.895 0.00 0.00 37.18 3.32
2703 3861 2.033448 TTTGCAACGGGGCGATCT 59.967 55.556 0.00 0.00 36.28 2.75
2843 6910 1.216710 GTCAGCGGAGGAGAAGTGG 59.783 63.158 0.00 0.00 0.00 4.00
2922 7540 4.851179 GGTTGGTCGCCCGATCCC 62.851 72.222 0.00 0.00 0.00 3.85
2926 7544 4.367023 CGAAGGTTGGTCGCCCGA 62.367 66.667 0.00 0.00 0.00 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.