Multiple sequence alignment - TraesCS1D01G299000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G299000 chr1D 100.000 2216 0 0 1 2216 397108214 397110429 0 4093
1 TraesCS1D01G299000 chr1D 93.035 1005 58 9 1 997 460400503 460401503 0 1458
2 TraesCS1D01G299000 chrUn 96.753 1232 30 6 995 2216 93410808 93412039 0 2045
3 TraesCS1D01G299000 chr5D 96.585 1230 34 6 995 2216 503217040 503215811 0 2032
4 TraesCS1D01G299000 chr5D 96.257 1229 38 5 995 2216 329121284 329122511 0 2008
5 TraesCS1D01G299000 chr2D 96.507 1231 34 5 995 2216 272795071 272796301 0 2026
6 TraesCS1D01G299000 chr2D 94.821 1004 43 7 1 995 420892064 420891061 0 1557
7 TraesCS1D01G299000 chr2A 96.257 1229 38 7 995 2216 335829717 335828490 0 2008
8 TraesCS1D01G299000 chr2A 93.625 1004 50 11 1 995 769568371 769569369 0 1487
9 TraesCS1D01G299000 chr6D 96.182 1231 38 6 995 2216 168250362 168249132 0 2004
10 TraesCS1D01G299000 chr6D 93.855 1009 44 14 1 995 303744850 303743846 0 1504
11 TraesCS1D01G299000 chr6D 93.819 1003 54 5 1 995 284296721 284295719 0 1502
12 TraesCS1D01G299000 chr6D 93.812 1002 50 10 1 994 198757261 198756264 0 1496
13 TraesCS1D01G299000 chr3A 95.935 1230 41 6 995 2216 672911187 672912415 0 1986
14 TraesCS1D01G299000 chr6A 95.458 1233 45 6 995 2216 260117458 260118690 0 1956
15 TraesCS1D01G299000 chr7A 93.816 1229 66 8 995 2216 352182986 352184211 0 1840
16 TraesCS1D01G299000 chr7D 93.942 1007 47 12 1 998 41229834 41230835 0 1509
17 TraesCS1D01G299000 chr3D 93.719 1003 53 7 1 994 231609887 231608886 0 1495
18 TraesCS1D01G299000 chr3D 93.241 1006 46 15 1 995 251096891 251095897 0 1461


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G299000 chr1D 397108214 397110429 2215 False 4093 4093 100.000 1 2216 1 chr1D.!!$F1 2215
1 TraesCS1D01G299000 chr1D 460400503 460401503 1000 False 1458 1458 93.035 1 997 1 chr1D.!!$F2 996
2 TraesCS1D01G299000 chrUn 93410808 93412039 1231 False 2045 2045 96.753 995 2216 1 chrUn.!!$F1 1221
3 TraesCS1D01G299000 chr5D 503215811 503217040 1229 True 2032 2032 96.585 995 2216 1 chr5D.!!$R1 1221
4 TraesCS1D01G299000 chr5D 329121284 329122511 1227 False 2008 2008 96.257 995 2216 1 chr5D.!!$F1 1221
5 TraesCS1D01G299000 chr2D 272795071 272796301 1230 False 2026 2026 96.507 995 2216 1 chr2D.!!$F1 1221
6 TraesCS1D01G299000 chr2D 420891061 420892064 1003 True 1557 1557 94.821 1 995 1 chr2D.!!$R1 994
7 TraesCS1D01G299000 chr2A 335828490 335829717 1227 True 2008 2008 96.257 995 2216 1 chr2A.!!$R1 1221
8 TraesCS1D01G299000 chr2A 769568371 769569369 998 False 1487 1487 93.625 1 995 1 chr2A.!!$F1 994
9 TraesCS1D01G299000 chr6D 168249132 168250362 1230 True 2004 2004 96.182 995 2216 1 chr6D.!!$R1 1221
10 TraesCS1D01G299000 chr6D 303743846 303744850 1004 True 1504 1504 93.855 1 995 1 chr6D.!!$R4 994
11 TraesCS1D01G299000 chr6D 284295719 284296721 1002 True 1502 1502 93.819 1 995 1 chr6D.!!$R3 994
12 TraesCS1D01G299000 chr6D 198756264 198757261 997 True 1496 1496 93.812 1 994 1 chr6D.!!$R2 993
13 TraesCS1D01G299000 chr3A 672911187 672912415 1228 False 1986 1986 95.935 995 2216 1 chr3A.!!$F1 1221
14 TraesCS1D01G299000 chr6A 260117458 260118690 1232 False 1956 1956 95.458 995 2216 1 chr6A.!!$F1 1221
15 TraesCS1D01G299000 chr7A 352182986 352184211 1225 False 1840 1840 93.816 995 2216 1 chr7A.!!$F1 1221
16 TraesCS1D01G299000 chr7D 41229834 41230835 1001 False 1509 1509 93.942 1 998 1 chr7D.!!$F1 997
17 TraesCS1D01G299000 chr3D 231608886 231609887 1001 True 1495 1495 93.719 1 994 1 chr3D.!!$R1 993
18 TraesCS1D01G299000 chr3D 251095897 251096891 994 True 1461 1461 93.241 1 995 1 chr3D.!!$R2 994

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
536 544 2.038033 TGGACCCGAAAGTCTACAAAGG 59.962 50.0 0.0 0.0 36.95 3.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1499 1524 2.103094 CTCGATAGGGCATGAGGTTCAA 59.897 50.0 0.0 0.0 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
305 307 4.311606 GCCAAACAAAACCCAAATATCGT 58.688 39.130 0.00 0.0 0.00 3.73
445 453 3.740115 ACACCGCAAAAGAGTTACATCT 58.260 40.909 0.00 0.0 0.00 2.90
496 504 3.960102 AGAATTCAGCGAGAGAGAGGAAT 59.040 43.478 8.44 0.0 0.00 3.01
525 533 4.284178 AGCTACTAACTATGGACCCGAAA 58.716 43.478 0.00 0.0 0.00 3.46
536 544 2.038033 TGGACCCGAAAGTCTACAAAGG 59.962 50.000 0.00 0.0 36.95 3.11
769 781 3.347216 CCCATTAGGTGTCTTCTGGTTG 58.653 50.000 0.00 0.0 0.00 3.77
1037 1056 4.040706 AGAAACAATAGTAACGTGGTCCCA 59.959 41.667 0.00 0.0 0.00 4.37
1137 1156 6.099269 ACATAACAAATCCTATGGTAGGTCGT 59.901 38.462 3.15 0.0 46.32 4.34
1196 1215 5.801947 CGAGTTATGAAAATGCAAGAAAGGG 59.198 40.000 0.00 0.0 0.00 3.95
1290 1314 3.562182 AGGCGGGGAATAACCTTATTTG 58.438 45.455 0.00 0.0 38.98 2.32
1359 1383 3.876309 AAAGTGGGCTAAGGAAACTCA 57.124 42.857 0.00 0.0 42.68 3.41
1411 1435 7.980099 ACTTAAGTTCGAGAGAGTTTTCAAAGA 59.020 33.333 1.12 0.0 43.69 2.52
1470 1495 3.690139 AGAGTTCTTGACGAGATTCGCTA 59.310 43.478 0.00 0.0 45.12 4.26
1554 1579 6.152154 CCCATCTTAAAGTTGGTTTATTCGGT 59.848 38.462 0.00 0.0 34.09 4.69
1594 1619 7.615365 ACTCATTATAGGGATTTTGACAAAGCA 59.385 33.333 0.10 0.0 29.18 3.91
1856 1888 4.415881 ACCCAAAAACACCATTCCTTTC 57.584 40.909 0.00 0.0 0.00 2.62
1977 2011 9.213799 GGCTCGAATAGAAAAATAGAATCAGAT 57.786 33.333 0.00 0.0 0.00 2.90
2093 2127 8.197439 TGATACGATCCACATCATAATCCATAC 58.803 37.037 0.00 0.0 0.00 2.39
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
305 307 9.742144 ATCTCTTATAGCCTCGTATTTCTTCTA 57.258 33.333 0.00 0.00 0.00 2.10
445 453 5.429762 ACAATGGTCTCTTGGAGATCCATAA 59.570 40.000 20.61 0.00 46.97 1.90
496 504 6.246919 GGTCCATAGTTAGTAGCTAGATGGA 58.753 44.000 12.23 12.23 33.77 3.41
525 533 3.190953 GCGTGAGTAGTCCTTTGTAGACT 59.809 47.826 0.00 0.00 46.22 3.24
536 544 1.333931 TCCGATGATGCGTGAGTAGTC 59.666 52.381 0.00 0.00 0.00 2.59
849 865 2.337532 CCAAGTGCCAGTTGCTGC 59.662 61.111 6.75 0.00 42.00 5.25
983 1002 7.348080 TCCTTCATATTGACTGATACGTCTT 57.652 36.000 0.00 0.00 35.00 3.01
1037 1056 2.370189 GTGGGTAGAATGCTAGATGCCT 59.630 50.000 0.00 0.00 42.00 4.75
1137 1156 2.104170 GGCACGAATTCCCCCAATTTA 58.896 47.619 0.00 0.00 34.60 1.40
1196 1215 8.612233 ATTCAGTTAACGACGAGATTTAGTAC 57.388 34.615 0.00 0.00 0.00 2.73
1376 1400 8.044908 ACTCTCTCGAACTTAAGTAGAAGATCT 58.955 37.037 8.92 0.00 0.00 2.75
1381 1405 8.627403 TGAAAACTCTCTCGAACTTAAGTAGAA 58.373 33.333 8.92 0.00 0.00 2.10
1411 1435 6.235664 ACAGACATAGGGATACGTTTTTGTT 58.764 36.000 0.00 0.00 35.44 2.83
1470 1495 4.332428 ACAGTTTCCTTGTAGTAACGCT 57.668 40.909 0.00 0.00 0.00 5.07
1499 1524 2.103094 CTCGATAGGGCATGAGGTTCAA 59.897 50.000 0.00 0.00 0.00 2.69
1554 1579 2.917933 AATGAGTAGCATTTGCGGCTA 58.082 42.857 0.00 0.00 44.68 3.93
1601 1626 8.142551 CCTACTGACTTCGGCTTTAGTAATAAT 58.857 37.037 0.00 0.00 0.00 1.28
1856 1888 3.330766 TTTTTGGTTGTGCGAACCG 57.669 47.368 11.69 0.00 43.15 4.44
1977 2011 7.972832 ATGTGTAATTACTTCGGAACTTGAA 57.027 32.000 16.33 0.00 0.00 2.69
2020 2054 6.987992 TGTGTAATTACTTCGGAACTTGAACT 59.012 34.615 16.33 0.00 0.00 3.01
2116 2152 7.782049 TCTAATTCTTCGATTGCTCCTCTTTA 58.218 34.615 0.00 0.00 0.00 1.85
2120 2156 5.837437 TCTCTAATTCTTCGATTGCTCCTC 58.163 41.667 0.00 0.00 0.00 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.