Multiple sequence alignment - TraesCS1D01G298900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G298900 chr1D 100.000 2219 0 0 1 2219 397088804 397091022 0.000000e+00 4098
1 TraesCS1D01G298900 chr1D 95.643 941 39 2 1280 2219 452321617 452322556 0.000000e+00 1509
2 TraesCS1D01G298900 chr1D 95.223 942 41 4 1280 2219 54213392 54214331 0.000000e+00 1487
3 TraesCS1D01G298900 chr3B 94.609 1317 35 19 1 1284 201527151 201525838 0.000000e+00 2006
4 TraesCS1D01G298900 chr6D 94.385 1318 34 23 1 1284 168251665 168250354 0.000000e+00 1988
5 TraesCS1D01G298900 chr6D 97.265 1170 26 5 1 1168 168255053 168253888 0.000000e+00 1978
6 TraesCS1D01G298900 chr5D 94.301 1316 41 18 1 1284 6189067 6187754 0.000000e+00 1984
7 TraesCS1D01G298900 chr5D 97.265 1170 26 5 1 1168 503218345 503217180 0.000000e+00 1978
8 TraesCS1D01G298900 chrUn 97.179 1170 27 5 1 1168 216518475 216519640 0.000000e+00 1973
9 TraesCS1D01G298900 chrUn 97.094 1170 27 6 1 1168 93409504 93410668 0.000000e+00 1965
10 TraesCS1D01G298900 chrUn 96.926 1171 30 5 1 1168 216521863 216523030 0.000000e+00 1958
11 TraesCS1D01G298900 chrUn 96.838 1170 31 5 1 1168 372771526 372772691 0.000000e+00 1951
12 TraesCS1D01G298900 chr2B 94.068 1315 44 17 1 1284 474908580 474907269 0.000000e+00 1965
13 TraesCS1D01G298900 chr2D 96.923 1170 30 5 1 1168 272793766 272794931 0.000000e+00 1956
14 TraesCS1D01G298900 chr2D 95.329 942 42 2 1280 2219 297342642 297341701 0.000000e+00 1495
15 TraesCS1D01G298900 chr2D 95.047 949 43 4 1273 2219 164290684 164291630 0.000000e+00 1489
16 TraesCS1D01G298900 chr3D 96.923 1170 29 6 1 1168 589279415 589280579 0.000000e+00 1954
17 TraesCS1D01G298900 chr3D 94.488 1270 35 19 47 1284 571591919 571593185 0.000000e+00 1925
18 TraesCS1D01G298900 chr3D 95.329 942 40 4 1280 2219 254332532 254331593 0.000000e+00 1493
19 TraesCS1D01G298900 chr3D 95.329 942 40 3 1280 2219 422777839 422776900 0.000000e+00 1493
20 TraesCS1D01G298900 chr3D 94.473 959 49 4 1263 2219 475529281 475530237 0.000000e+00 1474
21 TraesCS1D01G298900 chr7D 95.430 941 40 3 1280 2219 363952825 363951887 0.000000e+00 1496
22 TraesCS1D01G298900 chr7D 95.233 944 40 5 1279 2219 273708288 273707347 0.000000e+00 1489
23 TraesCS1D01G298900 chr4A 93.212 825 22 17 491 1284 73813300 73814121 0.000000e+00 1182
24 TraesCS1D01G298900 chr7A 87.774 319 16 15 988 1284 591505729 591506046 3.510000e-93 351
25 TraesCS1D01G298900 chr4D 94.262 122 5 2 1163 1284 207372977 207372858 3.760000e-43 185
26 TraesCS1D01G298900 chr6A 94.215 121 6 1 1164 1284 260117347 260117466 1.350000e-42 183


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G298900 chr1D 397088804 397091022 2218 False 4098.0 4098 100.0000 1 2219 1 chr1D.!!$F2 2218
1 TraesCS1D01G298900 chr1D 452321617 452322556 939 False 1509.0 1509 95.6430 1280 2219 1 chr1D.!!$F3 939
2 TraesCS1D01G298900 chr1D 54213392 54214331 939 False 1487.0 1487 95.2230 1280 2219 1 chr1D.!!$F1 939
3 TraesCS1D01G298900 chr3B 201525838 201527151 1313 True 2006.0 2006 94.6090 1 1284 1 chr3B.!!$R1 1283
4 TraesCS1D01G298900 chr6D 168250354 168255053 4699 True 1983.0 1988 95.8250 1 1284 2 chr6D.!!$R1 1283
5 TraesCS1D01G298900 chr5D 6187754 6189067 1313 True 1984.0 1984 94.3010 1 1284 1 chr5D.!!$R1 1283
6 TraesCS1D01G298900 chr5D 503217180 503218345 1165 True 1978.0 1978 97.2650 1 1168 1 chr5D.!!$R2 1167
7 TraesCS1D01G298900 chrUn 216518475 216523030 4555 False 1965.5 1973 97.0525 1 1168 2 chrUn.!!$F3 1167
8 TraesCS1D01G298900 chrUn 93409504 93410668 1164 False 1965.0 1965 97.0940 1 1168 1 chrUn.!!$F1 1167
9 TraesCS1D01G298900 chrUn 372771526 372772691 1165 False 1951.0 1951 96.8380 1 1168 1 chrUn.!!$F2 1167
10 TraesCS1D01G298900 chr2B 474907269 474908580 1311 True 1965.0 1965 94.0680 1 1284 1 chr2B.!!$R1 1283
11 TraesCS1D01G298900 chr2D 272793766 272794931 1165 False 1956.0 1956 96.9230 1 1168 1 chr2D.!!$F2 1167
12 TraesCS1D01G298900 chr2D 297341701 297342642 941 True 1495.0 1495 95.3290 1280 2219 1 chr2D.!!$R1 939
13 TraesCS1D01G298900 chr2D 164290684 164291630 946 False 1489.0 1489 95.0470 1273 2219 1 chr2D.!!$F1 946
14 TraesCS1D01G298900 chr3D 589279415 589280579 1164 False 1954.0 1954 96.9230 1 1168 1 chr3D.!!$F3 1167
15 TraesCS1D01G298900 chr3D 571591919 571593185 1266 False 1925.0 1925 94.4880 47 1284 1 chr3D.!!$F2 1237
16 TraesCS1D01G298900 chr3D 254331593 254332532 939 True 1493.0 1493 95.3290 1280 2219 1 chr3D.!!$R1 939
17 TraesCS1D01G298900 chr3D 422776900 422777839 939 True 1493.0 1493 95.3290 1280 2219 1 chr3D.!!$R2 939
18 TraesCS1D01G298900 chr3D 475529281 475530237 956 False 1474.0 1474 94.4730 1263 2219 1 chr3D.!!$F1 956
19 TraesCS1D01G298900 chr7D 363951887 363952825 938 True 1496.0 1496 95.4300 1280 2219 1 chr7D.!!$R2 939
20 TraesCS1D01G298900 chr7D 273707347 273708288 941 True 1489.0 1489 95.2330 1279 2219 1 chr7D.!!$R1 940
21 TraesCS1D01G298900 chr4A 73813300 73814121 821 False 1182.0 1182 93.2120 491 1284 1 chr4A.!!$F1 793

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
912 918 1.357761 CACAACCCCTTGGGGTTATCT 59.642 52.381 34.97 20.94 42.24 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2098 4604 3.700539 TCTCCGATATGTGGGTTTCGTTA 59.299 43.478 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
113 114 7.867403 GGAGAAGATAAAATTGTTTGAAGCACA 59.133 33.333 0.00 0.00 0.00 4.57
223 224 2.025699 GCAGTGGTAATTAAGACCCCCA 60.026 50.000 6.83 0.00 35.99 4.96
274 276 7.496346 ACCCATAATATGTGGAAGTATCGAT 57.504 36.000 2.16 2.16 39.12 3.59
283 285 6.822073 TGTGGAAGTATCGATGTAATTTCG 57.178 37.500 8.54 0.00 37.94 3.46
301 303 4.553756 TTCGTAGAGTCATTCGATCTGG 57.446 45.455 0.00 0.00 38.43 3.86
463 465 4.009675 AGATCCATCTGTCTAGAGATCGC 58.990 47.826 10.21 0.00 38.60 4.58
667 671 5.007034 TCATTGCAAAAGAGGGTAAATCGA 58.993 37.500 1.71 0.00 0.00 3.59
688 692 7.649533 TCGACCACTTTAAGATTACCATCTA 57.350 36.000 0.00 0.00 39.00 1.98
720 724 5.390613 CGTTTAGTATCCCAAAACTGCTTG 58.609 41.667 0.00 0.00 32.25 4.01
912 918 1.357761 CACAACCCCTTGGGGTTATCT 59.642 52.381 34.97 20.94 42.24 1.98
1107 1114 1.656652 CCTTGATCCACTTGGCTACG 58.343 55.000 0.00 0.00 34.44 3.51
1425 3278 1.243902 ACATAAACAACCCCTGCACG 58.756 50.000 0.00 0.00 0.00 5.34
1651 3747 5.679734 AGTAGATCGCAAAGGCAAATATG 57.320 39.130 0.00 0.00 41.24 1.78
1666 3775 4.336713 GCAAATATGTGAGAAAGAGACCCC 59.663 45.833 0.00 0.00 0.00 4.95
1754 3864 5.047802 ACTGTTGGGCAATTGATAGAACTTG 60.048 40.000 10.34 6.04 0.00 3.16
1835 3946 1.676678 GACCGACTCCTGCCTGCATA 61.677 60.000 0.00 0.00 0.00 3.14
2082 4588 4.337555 CACCTCTTCCCATTGCAAGATAAG 59.662 45.833 4.94 6.31 0.00 1.73
2098 4604 6.352516 CAAGATAAGTAGATCAAGTTGGCCT 58.647 40.000 3.32 3.33 0.00 5.19
2102 4608 4.124851 AGTAGATCAAGTTGGCCTAACG 57.875 45.455 3.32 0.00 44.15 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 3.488553 GCTGCCGTTACTCAACAGTTTTT 60.489 43.478 0.00 0.00 34.05 1.94
95 96 6.625362 TCTGTGTGTGCTTCAAACAATTTTA 58.375 32.000 6.85 0.00 42.85 1.52
113 114 2.665185 GCGCTTCCGGTTCTGTGT 60.665 61.111 0.00 0.00 34.32 3.72
274 276 7.644157 CAGATCGAATGACTCTACGAAATTACA 59.356 37.037 0.00 0.00 38.22 2.41
283 285 4.022416 AGCATCCAGATCGAATGACTCTAC 60.022 45.833 8.60 0.00 0.00 2.59
301 303 5.528690 TGGCTTATGTTCTTCATGTAGCATC 59.471 40.000 13.97 0.00 42.20 3.91
463 465 6.477033 GCATACGGCTTTCTAGATGTATATGG 59.523 42.308 0.00 0.00 40.25 2.74
632 636 4.560136 TTTGCAATGAGTTTCGCTACAA 57.440 36.364 0.00 0.00 0.00 2.41
667 671 6.906901 TCCCTAGATGGTAATCTTAAAGTGGT 59.093 38.462 0.00 0.00 40.42 4.16
688 692 2.675583 GGATACTAAACGGACCTCCCT 58.324 52.381 0.00 0.00 0.00 4.20
720 724 1.507141 CCACTTGTCCGACTGTTGCC 61.507 60.000 0.00 0.00 0.00 4.52
847 852 0.539986 TTCCCTTCACCGCTACCATC 59.460 55.000 0.00 0.00 0.00 3.51
852 857 0.249398 GAGCTTTCCCTTCACCGCTA 59.751 55.000 0.00 0.00 0.00 4.26
853 858 1.003233 GAGCTTTCCCTTCACCGCT 60.003 57.895 0.00 0.00 0.00 5.52
912 918 1.967319 AGTTCTTCTTCCAAGCGCAA 58.033 45.000 11.47 0.00 0.00 4.85
1107 1114 1.119574 TAGCTGGATAAGGGGCGGAC 61.120 60.000 0.00 0.00 0.00 4.79
1229 1270 7.872113 AATGAGGAGCTACAAAAGGATTTAG 57.128 36.000 0.00 0.00 37.28 1.85
1231 1272 8.829373 ATAAATGAGGAGCTACAAAAGGATTT 57.171 30.769 0.00 0.00 42.41 2.17
1342 3195 8.652290 GTTTCATATCTGAGGGAAATACCTACT 58.348 37.037 0.00 0.00 42.10 2.57
1425 3278 3.487544 GGTTGCGAGGATTTGTTATCTGC 60.488 47.826 0.00 0.00 0.00 4.26
1568 3423 6.503589 AATACAAAAATACCTTGCTGCGTA 57.496 33.333 0.00 0.00 0.00 4.42
1651 3747 1.597461 CCCGGGGTCTCTTTCTCAC 59.403 63.158 14.71 0.00 0.00 3.51
1666 3775 1.606885 TAGTGAAACCTACGGCCCCG 61.607 60.000 4.96 4.96 41.55 5.73
1690 3799 5.334569 CGTTTGCTATTTTTCTCGAGGGAAA 60.335 40.000 13.56 13.71 33.98 3.13
1754 3864 6.595326 TGCCTGGATATCGTCATGATTATTTC 59.405 38.462 0.00 0.85 38.57 2.17
1835 3946 7.174599 GGTCGATGTGTGGAGTAATAGTAGTAT 59.825 40.741 0.00 0.00 0.00 2.12
2082 4588 4.119442 TCGTTAGGCCAACTTGATCTAC 57.881 45.455 5.01 0.00 34.77 2.59
2098 4604 3.700539 TCTCCGATATGTGGGTTTCGTTA 59.299 43.478 0.00 0.00 0.00 3.18
2102 4608 4.402056 TCTTCTCCGATATGTGGGTTTC 57.598 45.455 0.00 0.00 0.00 2.78


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.