Multiple sequence alignment - TraesCS1D01G298800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G298800 chr1D 100.000 2378 0 0 1 2378 397088360 397090737 0.000000e+00 4392
1 TraesCS1D01G298800 chr3B 95.406 1763 43 20 1 1728 201527597 201525838 0.000000e+00 2772
2 TraesCS1D01G298800 chr6D 97.277 1616 36 6 1 1612 168255499 168253888 0.000000e+00 2734
3 TraesCS1D01G298800 chr6D 94.561 1434 36 24 331 1728 168251781 168250354 0.000000e+00 2178
4 TraesCS1D01G298800 chr6D 95.579 656 28 1 1724 2378 293156663 293156008 0.000000e+00 1050
5 TraesCS1D01G298800 chr6D 95.434 657 26 4 1724 2378 369489885 369490539 0.000000e+00 1044
6 TraesCS1D01G298800 chr5D 95.006 1762 52 19 1 1728 6189513 6187754 0.000000e+00 2734
7 TraesCS1D01G298800 chr5D 97.277 1616 36 6 1 1612 503218791 503217180 0.000000e+00 2734
8 TraesCS1D01G298800 chr5D 95.579 656 26 3 1724 2378 128738876 128738223 0.000000e+00 1048
9 TraesCS1D01G298800 chr5D 94.092 677 37 3 1704 2378 340628258 340628933 0.000000e+00 1026
10 TraesCS1D01G298800 chrUn 97.150 1614 38 6 3 1612 216518031 216519640 0.000000e+00 2719
11 TraesCS1D01G298800 chrUn 97.092 1616 38 7 1 1612 93409058 93410668 0.000000e+00 2715
12 TraesCS1D01G298800 chrUn 96.844 1616 43 6 1 1612 372771080 372772691 0.000000e+00 2695
13 TraesCS1D01G298800 chr3D 96.968 1616 38 8 1 1612 589278971 589280579 0.000000e+00 2702
14 TraesCS1D01G298800 chr3D 94.488 1270 35 19 491 1728 571591919 571593185 0.000000e+00 1925
15 TraesCS1D01G298800 chr3D 95.296 659 28 3 1721 2378 422816026 422815370 0.000000e+00 1042
16 TraesCS1D01G298800 chr3D 95.441 658 21 7 1724 2378 421798496 421797845 0.000000e+00 1040
17 TraesCS1D01G298800 chr2D 96.906 1616 42 6 1 1612 272793320 272794931 0.000000e+00 2700
18 TraesCS1D01G298800 chr2B 94.605 1761 55 19 1 1728 474909022 474907269 0.000000e+00 2689
19 TraesCS1D01G298800 chr4A 93.212 825 22 17 935 1728 73813300 73814121 0.000000e+00 1182
20 TraesCS1D01G298800 chr7D 95.579 656 28 1 1724 2378 40921572 40922227 0.000000e+00 1050
21 TraesCS1D01G298800 chr7D 95.159 661 28 4 1721 2378 474282166 474282825 0.000000e+00 1040
22 TraesCS1D01G298800 chr4D 95.420 655 30 0 1724 2378 325993356 325994010 0.000000e+00 1044
23 TraesCS1D01G298800 chr4D 94.262 122 5 2 1607 1728 207372977 207372858 4.040000e-43 185
24 TraesCS1D01G298800 chr7A 87.774 319 16 15 1432 1728 591505729 591506046 3.760000e-93 351
25 TraesCS1D01G298800 chr6A 94.215 121 6 1 1608 1728 260117347 260117466 1.450000e-42 183


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G298800 chr1D 397088360 397090737 2377 False 4392 4392 100.000 1 2378 1 chr1D.!!$F1 2377
1 TraesCS1D01G298800 chr3B 201525838 201527597 1759 True 2772 2772 95.406 1 1728 1 chr3B.!!$R1 1727
2 TraesCS1D01G298800 chr6D 168250354 168255499 5145 True 2456 2734 95.919 1 1728 2 chr6D.!!$R2 1727
3 TraesCS1D01G298800 chr6D 293156008 293156663 655 True 1050 1050 95.579 1724 2378 1 chr6D.!!$R1 654
4 TraesCS1D01G298800 chr6D 369489885 369490539 654 False 1044 1044 95.434 1724 2378 1 chr6D.!!$F1 654
5 TraesCS1D01G298800 chr5D 6187754 6189513 1759 True 2734 2734 95.006 1 1728 1 chr5D.!!$R1 1727
6 TraesCS1D01G298800 chr5D 503217180 503218791 1611 True 2734 2734 97.277 1 1612 1 chr5D.!!$R3 1611
7 TraesCS1D01G298800 chr5D 128738223 128738876 653 True 1048 1048 95.579 1724 2378 1 chr5D.!!$R2 654
8 TraesCS1D01G298800 chr5D 340628258 340628933 675 False 1026 1026 94.092 1704 2378 1 chr5D.!!$F1 674
9 TraesCS1D01G298800 chrUn 216518031 216519640 1609 False 2719 2719 97.150 3 1612 1 chrUn.!!$F2 1609
10 TraesCS1D01G298800 chrUn 93409058 93410668 1610 False 2715 2715 97.092 1 1612 1 chrUn.!!$F1 1611
11 TraesCS1D01G298800 chrUn 372771080 372772691 1611 False 2695 2695 96.844 1 1612 1 chrUn.!!$F3 1611
12 TraesCS1D01G298800 chr3D 589278971 589280579 1608 False 2702 2702 96.968 1 1612 1 chr3D.!!$F2 1611
13 TraesCS1D01G298800 chr3D 571591919 571593185 1266 False 1925 1925 94.488 491 1728 1 chr3D.!!$F1 1237
14 TraesCS1D01G298800 chr3D 422815370 422816026 656 True 1042 1042 95.296 1721 2378 1 chr3D.!!$R2 657
15 TraesCS1D01G298800 chr3D 421797845 421798496 651 True 1040 1040 95.441 1724 2378 1 chr3D.!!$R1 654
16 TraesCS1D01G298800 chr2D 272793320 272794931 1611 False 2700 2700 96.906 1 1612 1 chr2D.!!$F1 1611
17 TraesCS1D01G298800 chr2B 474907269 474909022 1753 True 2689 2689 94.605 1 1728 1 chr2B.!!$R1 1727
18 TraesCS1D01G298800 chr4A 73813300 73814121 821 False 1182 1182 93.212 935 1728 1 chr4A.!!$F1 793
19 TraesCS1D01G298800 chr7D 40921572 40922227 655 False 1050 1050 95.579 1724 2378 1 chr7D.!!$F1 654
20 TraesCS1D01G298800 chr7D 474282166 474282825 659 False 1040 1040 95.159 1721 2378 1 chr7D.!!$F2 657
21 TraesCS1D01G298800 chr4D 325993356 325994010 654 False 1044 1044 95.420 1724 2378 1 chr4D.!!$F1 654

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
667 670 2.025699 GCAGTGGTAATTAAGACCCCCA 60.026 50.0 6.83 0.0 35.99 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1940 3795 0.250124 ATCTCACGTCCGTTTGCCAA 60.25 50.0 0.0 0.0 0.0 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
46 47 5.820423 ACGAAATAATTTGATCCATGGACGA 59.180 36.000 18.99 8.35 0.00 4.20
75 76 4.970711 TGTGGTAAAGGTCGTAATTCCAA 58.029 39.130 0.00 0.00 0.00 3.53
145 146 9.385902 CTATACCGTAAAATAGATTTTCGACGA 57.614 33.333 18.09 0.00 40.98 4.20
241 242 3.397527 ACACTATGGGGATGGTGAGAAT 58.602 45.455 5.65 0.00 36.65 2.40
448 451 3.952323 CTCTACGGGATAGACCTCAACAA 59.048 47.826 0.00 0.00 34.80 2.83
557 560 7.867403 GGAGAAGATAAAATTGTTTGAAGCACA 59.133 33.333 0.00 0.00 0.00 4.57
667 670 2.025699 GCAGTGGTAATTAAGACCCCCA 60.026 50.000 6.83 0.00 35.99 4.96
718 722 7.496346 ACCCATAATATGTGGAAGTATCGAT 57.504 36.000 2.16 2.16 39.12 3.59
727 731 6.822073 TGTGGAAGTATCGATGTAATTTCG 57.178 37.500 8.54 0.00 37.94 3.46
745 749 4.553756 TTCGTAGAGTCATTCGATCTGG 57.446 45.455 0.00 0.00 38.43 3.86
907 911 4.009675 AGATCCATCTGTCTAGAGATCGC 58.990 47.826 10.21 0.00 38.60 4.58
1111 1116 5.007034 TCATTGCAAAAGAGGGTAAATCGA 58.993 37.500 1.71 0.00 0.00 3.59
1132 1137 7.649533 TCGACCACTTTAAGATTACCATCTA 57.350 36.000 0.00 0.00 39.00 1.98
1164 1169 5.390613 CGTTTAGTATCCCAAAACTGCTTG 58.609 41.667 0.00 0.00 32.25 4.01
1356 1363 1.357761 CACAACCCCTTGGGGTTATCT 59.642 52.381 34.97 20.94 42.24 1.98
1551 1558 1.656652 CCTTGATCCACTTGGCTACG 58.343 55.000 0.00 0.00 34.44 3.51
1869 3721 1.243902 ACATAAACAACCCCTGCACG 58.756 50.000 0.00 0.00 0.00 5.34
1940 3795 4.078516 GGGTACGGCGCCTCAAGT 62.079 66.667 26.68 17.45 0.00 3.16
2110 4224 4.336713 GCAAATATGTGAGAAAGAGACCCC 59.663 45.833 0.00 0.00 0.00 4.95
2138 4527 3.992427 CGTAGGTTTCACTAGTGGTTTCC 59.008 47.826 22.48 17.79 0.00 3.13
2198 4587 5.047802 ACTGTTGGGCAATTGATAGAACTTG 60.048 40.000 10.34 6.04 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
75 76 2.024414 GCCTTGCGGTAATGATTCCTT 58.976 47.619 0.00 0.00 0.00 3.36
172 173 8.145767 CGATTAGGGTTGTATTCTATGGTTACA 58.854 37.037 0.00 0.00 0.00 2.41
188 189 6.959639 AATGTATGCATTTCGATTAGGGTT 57.040 33.333 3.54 0.00 42.19 4.11
387 388 5.185056 TCAGTGATCGTTCTAGGTTTCATCA 59.815 40.000 0.00 0.00 0.00 3.07
448 451 3.488553 GCTGCCGTTACTCAACAGTTTTT 60.489 43.478 0.00 0.00 34.05 1.94
539 542 6.625362 TCTGTGTGTGCTTCAAACAATTTTA 58.375 32.000 6.85 0.00 42.85 1.52
557 560 2.665185 GCGCTTCCGGTTCTGTGT 60.665 61.111 0.00 0.00 34.32 3.72
718 722 7.644157 CAGATCGAATGACTCTACGAAATTACA 59.356 37.037 0.00 0.00 38.22 2.41
727 731 4.022416 AGCATCCAGATCGAATGACTCTAC 60.022 45.833 8.60 0.00 0.00 2.59
745 749 5.528690 TGGCTTATGTTCTTCATGTAGCATC 59.471 40.000 13.97 0.00 42.20 3.91
907 911 6.477033 GCATACGGCTTTCTAGATGTATATGG 59.523 42.308 0.00 0.00 40.25 2.74
1076 1081 4.560136 TTTGCAATGAGTTTCGCTACAA 57.440 36.364 0.00 0.00 0.00 2.41
1111 1116 6.906901 TCCCTAGATGGTAATCTTAAAGTGGT 59.093 38.462 0.00 0.00 40.42 4.16
1132 1137 2.675583 GGATACTAAACGGACCTCCCT 58.324 52.381 0.00 0.00 0.00 4.20
1164 1169 1.507141 CCACTTGTCCGACTGTTGCC 61.507 60.000 0.00 0.00 0.00 4.52
1291 1296 0.539986 TTCCCTTCACCGCTACCATC 59.460 55.000 0.00 0.00 0.00 3.51
1296 1301 0.249398 GAGCTTTCCCTTCACCGCTA 59.751 55.000 0.00 0.00 0.00 4.26
1297 1302 1.003233 GAGCTTTCCCTTCACCGCT 60.003 57.895 0.00 0.00 0.00 5.52
1356 1363 1.967319 AGTTCTTCTTCCAAGCGCAA 58.033 45.000 11.47 0.00 0.00 4.85
1551 1558 1.119574 TAGCTGGATAAGGGGCGGAC 61.120 60.000 0.00 0.00 0.00 4.79
1673 1713 7.872113 AATGAGGAGCTACAAAAGGATTTAG 57.128 36.000 0.00 0.00 37.28 1.85
1675 1715 8.829373 ATAAATGAGGAGCTACAAAAGGATTT 57.171 30.769 0.00 0.00 42.41 2.17
1786 3638 8.652290 GTTTCATATCTGAGGGAAATACCTACT 58.348 37.037 0.00 0.00 42.10 2.57
1869 3721 3.487544 GGTTGCGAGGATTTGTTATCTGC 60.488 47.826 0.00 0.00 0.00 4.26
1940 3795 0.250124 ATCTCACGTCCGTTTGCCAA 60.250 50.000 0.00 0.00 0.00 4.52
2012 3870 6.503589 AATACAAAAATACCTTGCTGCGTA 57.496 33.333 0.00 0.00 0.00 4.42
2110 4224 1.606885 TAGTGAAACCTACGGCCCCG 61.607 60.000 4.96 4.96 41.55 5.73
2138 4527 3.435671 ACCGTTTGCTATTTTTCTCGAGG 59.564 43.478 13.56 0.00 0.00 4.63
2198 4587 6.595326 TGCCTGGATATCGTCATGATTATTTC 59.405 38.462 0.00 0.85 38.57 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.