Multiple sequence alignment - TraesCS1D01G294900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G294900 chr1D 100.000 2627 0 0 1 2627 393952163 393949537 0.000000e+00 4852
1 TraesCS1D01G294900 chr1D 96.197 973 31 5 1659 2627 422495390 422496360 0.000000e+00 1587
2 TraesCS1D01G294900 chr5D 97.060 2653 51 8 1 2627 375001991 375004642 0.000000e+00 4442
3 TraesCS1D01G294900 chr5D 95.641 2661 78 13 1 2627 184453024 184455680 0.000000e+00 4237
4 TraesCS1D01G294900 chr5D 94.728 2504 105 7 1 2481 397473181 397470682 0.000000e+00 3868
5 TraesCS1D01G294900 chr5D 94.367 2503 111 12 3 2481 397466574 397469070 0.000000e+00 3814
6 TraesCS1D01G294900 chr3A 94.670 2514 107 9 124 2615 720600566 720598058 0.000000e+00 3875
7 TraesCS1D01G294900 chr3A 93.897 213 13 0 1 213 31316393 31316181 3.260000e-84 322
8 TraesCS1D01G294900 chr6B 93.036 2642 157 8 1 2615 666360969 666358328 0.000000e+00 3834
9 TraesCS1D01G294900 chr7A 96.178 2093 57 4 1 2074 692229365 692231453 0.000000e+00 3400
10 TraesCS1D01G294900 chr2A 95.095 1794 69 3 1 1775 33472830 33471037 0.000000e+00 2808
11 TraesCS1D01G294900 chr2A 96.002 1651 66 0 1 1651 478455590 478457240 0.000000e+00 2684
12 TraesCS1D01G294900 chr4B 92.940 1119 41 21 1547 2627 20345535 20344417 0.000000e+00 1594
13 TraesCS1D01G294900 chr4A 96.201 974 33 4 1658 2627 592507166 592508139 0.000000e+00 1591
14 TraesCS1D01G294900 chr4A 95.808 978 33 6 1658 2627 593073546 593074523 0.000000e+00 1572
15 TraesCS1D01G294900 chr4A 95.795 975 36 4 1658 2627 592785986 592786960 0.000000e+00 1568
16 TraesCS1D01G294900 chr4A 92.321 1120 44 22 1547 2627 591538091 591536975 0.000000e+00 1554
17 TraesCS1D01G294900 chr7D 95.992 973 35 4 1658 2627 39864017 39864988 0.000000e+00 1578
18 TraesCS1D01G294900 chr3B 95.087 977 40 7 1658 2627 442046680 442047655 0.000000e+00 1531


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G294900 chr1D 393949537 393952163 2626 True 4852 4852 100.000 1 2627 1 chr1D.!!$R1 2626
1 TraesCS1D01G294900 chr1D 422495390 422496360 970 False 1587 1587 96.197 1659 2627 1 chr1D.!!$F1 968
2 TraesCS1D01G294900 chr5D 375001991 375004642 2651 False 4442 4442 97.060 1 2627 1 chr5D.!!$F2 2626
3 TraesCS1D01G294900 chr5D 184453024 184455680 2656 False 4237 4237 95.641 1 2627 1 chr5D.!!$F1 2626
4 TraesCS1D01G294900 chr5D 397470682 397473181 2499 True 3868 3868 94.728 1 2481 1 chr5D.!!$R1 2480
5 TraesCS1D01G294900 chr5D 397466574 397469070 2496 False 3814 3814 94.367 3 2481 1 chr5D.!!$F3 2478
6 TraesCS1D01G294900 chr3A 720598058 720600566 2508 True 3875 3875 94.670 124 2615 1 chr3A.!!$R2 2491
7 TraesCS1D01G294900 chr6B 666358328 666360969 2641 True 3834 3834 93.036 1 2615 1 chr6B.!!$R1 2614
8 TraesCS1D01G294900 chr7A 692229365 692231453 2088 False 3400 3400 96.178 1 2074 1 chr7A.!!$F1 2073
9 TraesCS1D01G294900 chr2A 33471037 33472830 1793 True 2808 2808 95.095 1 1775 1 chr2A.!!$R1 1774
10 TraesCS1D01G294900 chr2A 478455590 478457240 1650 False 2684 2684 96.002 1 1651 1 chr2A.!!$F1 1650
11 TraesCS1D01G294900 chr4B 20344417 20345535 1118 True 1594 1594 92.940 1547 2627 1 chr4B.!!$R1 1080
12 TraesCS1D01G294900 chr4A 592507166 592508139 973 False 1591 1591 96.201 1658 2627 1 chr4A.!!$F1 969
13 TraesCS1D01G294900 chr4A 593073546 593074523 977 False 1572 1572 95.808 1658 2627 1 chr4A.!!$F3 969
14 TraesCS1D01G294900 chr4A 592785986 592786960 974 False 1568 1568 95.795 1658 2627 1 chr4A.!!$F2 969
15 TraesCS1D01G294900 chr4A 591536975 591538091 1116 True 1554 1554 92.321 1547 2627 1 chr4A.!!$R1 1080
16 TraesCS1D01G294900 chr7D 39864017 39864988 971 False 1578 1578 95.992 1658 2627 1 chr7D.!!$F1 969
17 TraesCS1D01G294900 chr3B 442046680 442047655 975 False 1531 1531 95.087 1658 2627 1 chr3B.!!$F1 969

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
516 518 2.558313 GTGGAGTTGCGCTTGAGC 59.442 61.111 9.73 0.0 37.78 4.26 F
1286 1291 2.359975 GCCCGGGAGACAAACTGG 60.360 66.667 29.31 0.0 0.00 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1378 1383 0.611200 CGTGGGATGGTGGTTGTAGA 59.389 55.0 0.00 0.0 0.0 2.59 R
2462 2528 2.222461 ACTTCCATATTAGGGGGCCA 57.778 50.0 4.39 0.0 0.0 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
144 145 4.023193 GGGTGATGAATGAACGAACAAACT 60.023 41.667 0.00 0.00 0.00 2.66
206 207 3.225798 GTGGTTGCAGCAAGCCCA 61.226 61.111 29.78 21.33 44.83 5.36
516 518 2.558313 GTGGAGTTGCGCTTGAGC 59.442 61.111 9.73 0.00 37.78 4.26
1286 1291 2.359975 GCCCGGGAGACAAACTGG 60.360 66.667 29.31 0.00 0.00 4.00
1391 1396 1.279271 GTCCAGCTCTACAACCACCAT 59.721 52.381 0.00 0.00 0.00 3.55
1692 1741 2.105128 GGTGAGTCGGCTCCATCG 59.895 66.667 15.72 0.00 40.95 3.84
1718 1767 2.224646 GCCCTAGCTCCCTATTTTCTGG 60.225 54.545 0.00 0.00 35.50 3.86
1872 1922 3.458189 AGCCATTACGTAGCTGAATCAC 58.542 45.455 6.98 0.00 34.99 3.06
1881 1931 0.667487 AGCTGAATCACGTCCGTGTG 60.667 55.000 18.23 0.00 45.55 3.82
1914 1964 7.712639 TCATCAGTTCATAGTATTTGGCTTCTC 59.287 37.037 0.00 0.00 0.00 2.87
2240 2290 7.065216 TGATCTGAATTCGACATTGAGTTTC 57.935 36.000 0.04 0.00 0.00 2.78
2244 2294 5.800296 TGAATTCGACATTGAGTTTCCCTA 58.200 37.500 0.04 0.00 0.00 3.53
2487 2555 3.591527 CCCCCTAATATGGAAGTATGGCA 59.408 47.826 0.00 0.00 0.00 4.92
2574 2644 1.000145 AATTGGACCGGGCCGATTT 60.000 52.632 33.45 18.51 38.60 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
144 145 4.042809 CCTGGTGCCCATGTTCCTATTATA 59.957 45.833 0.00 0.00 30.82 0.98
206 207 2.985282 TCGTCGGGCGTACAAGGT 60.985 61.111 0.49 0.00 42.13 3.50
283 284 7.756395 ACAGCCAGGATCTATGATAATTTTG 57.244 36.000 0.00 0.00 0.00 2.44
937 941 1.068472 ACGAGTGAAGCTACCAAGACG 60.068 52.381 0.00 0.00 0.00 4.18
1378 1383 0.611200 CGTGGGATGGTGGTTGTAGA 59.389 55.000 0.00 0.00 0.00 2.59
1391 1396 2.904866 GCAACCTTGTGCGTGGGA 60.905 61.111 0.00 0.00 34.21 4.37
1643 1648 0.674895 GTCGCCTCAAGAAGCACCAT 60.675 55.000 0.00 0.00 0.00 3.55
1718 1767 3.181461 ACCAACAGAGCATGCTATAGGAC 60.181 47.826 22.74 6.98 0.00 3.85
1872 1922 4.023739 TGATGATTAGTACACACGGACG 57.976 45.455 0.00 0.00 0.00 4.79
2240 2290 9.236691 CGACATTGTTTCATATTCAAATTAGGG 57.763 33.333 0.00 0.00 0.00 3.53
2244 2294 9.304731 CATCCGACATTGTTTCATATTCAAATT 57.695 29.630 0.00 0.00 0.00 1.82
2462 2528 2.222461 ACTTCCATATTAGGGGGCCA 57.778 50.000 4.39 0.00 0.00 5.36
2487 2555 7.710044 TGTATTTTTCTGTCAATTTGTGCATGT 59.290 29.630 0.00 0.00 0.00 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.