Multiple sequence alignment - TraesCS1D01G258700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G258700 chr1D 100.000 2488 0 0 1 2488 351079421 351076934 0 4595
1 TraesCS1D01G258700 chr6B 97.333 2512 41 7 1 2488 596620323 596622832 0 4244
2 TraesCS1D01G258700 chrUn 97.212 2511 46 6 1 2488 282364697 282362188 0 4228
3 TraesCS1D01G258700 chrUn 97.172 2511 47 6 1 2488 86510013 86507504 0 4222
4 TraesCS1D01G258700 chr3B 97.130 2509 49 5 1 2488 92317837 92320343 0 4213
5 TraesCS1D01G258700 chr4D 97.126 2505 53 5 1 2488 123423714 123426216 0 4209
6 TraesCS1D01G258700 chr2B 96.891 2509 53 8 1 2488 30670612 30668108 0 4178
7 TraesCS1D01G258700 chr6A 96.818 2514 53 6 1 2488 84434143 84436655 0 4174
8 TraesCS1D01G258700 chr6A 97.257 1859 34 3 646 2488 608882591 608880734 0 3134
9 TraesCS1D01G258700 chr3D 96.851 2509 56 6 1 2488 154704961 154702455 0 4174
10 TraesCS1D01G258700 chr6D 96.810 2508 58 5 1 2488 168766787 168769292 0 4169
11 TraesCS1D01G258700 chr7B 96.295 2510 60 6 1 2488 742916705 742919203 0 4089
12 TraesCS1D01G258700 chr7A 96.259 1684 44 5 822 2488 563584005 563585686 0 2743
13 TraesCS1D01G258700 chr7D 96.686 1388 23 4 1124 2488 203544854 203543467 0 2287


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G258700 chr1D 351076934 351079421 2487 True 4595 4595 100.000 1 2488 1 chr1D.!!$R1 2487
1 TraesCS1D01G258700 chr6B 596620323 596622832 2509 False 4244 4244 97.333 1 2488 1 chr6B.!!$F1 2487
2 TraesCS1D01G258700 chrUn 282362188 282364697 2509 True 4228 4228 97.212 1 2488 1 chrUn.!!$R2 2487
3 TraesCS1D01G258700 chrUn 86507504 86510013 2509 True 4222 4222 97.172 1 2488 1 chrUn.!!$R1 2487
4 TraesCS1D01G258700 chr3B 92317837 92320343 2506 False 4213 4213 97.130 1 2488 1 chr3B.!!$F1 2487
5 TraesCS1D01G258700 chr4D 123423714 123426216 2502 False 4209 4209 97.126 1 2488 1 chr4D.!!$F1 2487
6 TraesCS1D01G258700 chr2B 30668108 30670612 2504 True 4178 4178 96.891 1 2488 1 chr2B.!!$R1 2487
7 TraesCS1D01G258700 chr6A 84434143 84436655 2512 False 4174 4174 96.818 1 2488 1 chr6A.!!$F1 2487
8 TraesCS1D01G258700 chr6A 608880734 608882591 1857 True 3134 3134 97.257 646 2488 1 chr6A.!!$R1 1842
9 TraesCS1D01G258700 chr3D 154702455 154704961 2506 True 4174 4174 96.851 1 2488 1 chr3D.!!$R1 2487
10 TraesCS1D01G258700 chr6D 168766787 168769292 2505 False 4169 4169 96.810 1 2488 1 chr6D.!!$F1 2487
11 TraesCS1D01G258700 chr7B 742916705 742919203 2498 False 4089 4089 96.295 1 2488 1 chr7B.!!$F1 2487
12 TraesCS1D01G258700 chr7A 563584005 563585686 1681 False 2743 2743 96.259 822 2488 1 chr7A.!!$F1 1666
13 TraesCS1D01G258700 chr7D 203543467 203544854 1387 True 2287 2287 96.686 1124 2488 1 chr7D.!!$R1 1364

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
701 703 2.28419 GATTGCTTACTCTCAGCCACC 58.716 52.381 0.0 0.0 36.33 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2422 2465 0.743701 AGTCACGCCTAGACGACGAT 60.744 55.0 5.13 0.0 40.84 3.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
223 225 5.516339 CGCCAAGTCCATAATTCACAAATTC 59.484 40.000 0.00 0.0 36.49 2.17
701 703 2.284190 GATTGCTTACTCTCAGCCACC 58.716 52.381 0.00 0.0 36.33 4.61
752 754 6.257193 GGATTCCATTCGAAGTAACGTAACAT 59.743 38.462 3.35 0.0 32.78 2.71
804 806 4.694037 CCGGAGTTTTTCGATAAAAGGTCT 59.306 41.667 0.00 0.0 36.02 3.85
833 835 6.548622 CCTTCAATATCATGATTGGGTCAACT 59.451 38.462 14.65 0.0 40.97 3.16
1048 1050 2.430694 CCTGATGTAGTGGGATCGTTCA 59.569 50.000 0.00 0.0 0.00 3.18
1078 1080 3.012518 CAACCTCTAGCAGATGGTTTGG 58.987 50.000 12.63 0.0 35.23 3.28
1336 1338 3.439129 CAGTCGCCTATGATATACGGACA 59.561 47.826 0.00 0.0 0.00 4.02
1407 1410 1.151899 AGGTGTGGGCTTACAGGGA 60.152 57.895 0.00 0.0 0.00 4.20
1641 1661 5.586643 GGTTCTCCTACTTGATGGATGAAAC 59.413 44.000 0.00 0.0 0.00 2.78
1652 1672 6.258230 TGATGGATGAAACAACATGAGAAC 57.742 37.500 0.00 0.0 0.00 3.01
2015 2035 4.065088 TGTCATTGTCAGTCAACTAAGGC 58.935 43.478 0.00 0.0 38.97 4.35
2155 2179 2.711009 TGGTGAACCTCTCCTTGTGATT 59.289 45.455 0.37 0.0 36.82 2.57
2180 2204 1.316266 AGGTAGATGCCTCCCAGCT 59.684 57.895 0.00 0.0 43.77 4.24
2243 2271 6.221659 CGACCTACAGTTCTCCTTAAACTTT 58.778 40.000 0.00 0.0 34.79 2.66
2462 2505 6.012508 TGACTTCTTGTTTTGATCTCCCCTAT 60.013 38.462 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 4.743955 GCCTGTTCTGTCCTAAACTGTTCT 60.744 45.833 0.00 0.00 0.00 3.01
85 86 0.318762 GGGCTTCGAGGTGGCTATAG 59.681 60.000 0.00 0.00 0.00 1.31
419 421 8.996988 TCCATTTTGTTAAATATCGCGAATAC 57.003 30.769 15.24 5.81 32.75 1.89
458 460 6.809976 AGTAATCCCGGAACTCTAGAAATT 57.190 37.500 0.73 0.00 0.00 1.82
752 754 4.464008 AGAAGTTTTGAAGATGGTGCTCA 58.536 39.130 0.00 0.00 0.00 4.26
804 806 6.855667 ACCCAATCATGATATTGAAGGATGA 58.144 36.000 9.04 0.00 38.84 2.92
833 835 7.618019 ACTATTTCACTTATGATCTGGCCTA 57.382 36.000 3.32 0.00 33.85 3.93
1048 1050 6.344500 CATCTGCTAGAGGTTGTAACAATCT 58.656 40.000 0.00 0.52 33.08 2.40
1100 1102 7.040686 GGAGAAATTAGCACTACTTGGTGAAAA 60.041 37.037 0.00 0.00 39.34 2.29
1336 1338 5.163571 GCACAAACCCATTTTTGACCAATTT 60.164 36.000 2.70 0.00 38.54 1.82
1492 1495 3.244215 TGAGGTGCGAAGAGAAACATCTT 60.244 43.478 0.00 0.00 42.23 2.40
1622 1642 5.875224 TGTTGTTTCATCCATCAAGTAGGA 58.125 37.500 0.00 0.00 38.50 2.94
1641 1661 5.682943 TTTTAGAACCCGTTCTCATGTTG 57.317 39.130 13.21 0.00 46.13 3.33
1652 1672 7.619964 TTCTAGCCTTTTATTTTAGAACCCG 57.380 36.000 0.00 0.00 0.00 5.28
2155 2179 3.977086 AGGCATCTACCTCATCCCA 57.023 52.632 0.00 0.00 33.62 4.37
2243 2271 2.159114 GCTTCTTTTCCACCAAGCACAA 60.159 45.455 0.00 0.00 40.86 3.33
2422 2465 0.743701 AGTCACGCCTAGACGACGAT 60.744 55.000 5.13 0.00 40.84 3.73
2462 2505 0.911769 CCCAGACAACATCCTAGGCA 59.088 55.000 2.96 0.00 0.00 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.