Multiple sequence alignment - TraesCS1D01G258600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G258600 chr1D 100.000 2285 0 0 1 2285 351078253 351075969 0 4220
1 TraesCS1D01G258600 chr6A 97.486 2307 36 4 1 2285 608882069 608879763 0 3919
2 TraesCS1D01G258600 chrUn 97.276 2313 35 6 1 2285 86508845 86506533 0 3897
3 TraesCS1D01G258600 chrUn 96.410 2312 44 8 1 2285 260202560 260200261 0 3773
4 TraesCS1D01G258600 chrUn 96.410 2312 44 8 1 2285 270908055 270905756 0 3773
5 TraesCS1D01G258600 chrUn 96.622 1628 27 6 1 1600 282363529 282361902 0 2676
6 TraesCS1D01G258600 chr4D 97.269 2307 41 5 1 2285 123424881 123427187 0 3892
7 TraesCS1D01G258600 chr6B 97.148 2314 37 6 1 2285 596621490 596623803 0 3880
8 TraesCS1D01G258600 chr3B 97.144 2311 40 4 1 2285 92319004 92321314 0 3879
9 TraesCS1D01G258600 chr2B 96.841 2311 45 7 1 2285 30669446 30667138 0 3838
10 TraesCS1D01G258600 chr7A 96.749 2307 52 6 1 2285 563584351 563586656 0 3823
11 TraesCS1D01G258600 chr7B 96.626 2312 41 6 1 2285 742917873 742920174 0 3803
12 TraesCS1D01G258600 chr4A 96.464 2319 45 9 1 2285 67575518 67573203 0 3794
13 TraesCS1D01G258600 chr3D 96.127 1575 34 7 1 1549 154703793 154702220 0 2545
14 TraesCS1D01G258600 chr7D 96.657 1376 23 4 1 1353 203544809 203543434 0 2265


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G258600 chr1D 351075969 351078253 2284 True 4220 4220 100.000 1 2285 1 chr1D.!!$R1 2284
1 TraesCS1D01G258600 chr6A 608879763 608882069 2306 True 3919 3919 97.486 1 2285 1 chr6A.!!$R1 2284
2 TraesCS1D01G258600 chrUn 86506533 86508845 2312 True 3897 3897 97.276 1 2285 1 chrUn.!!$R1 2284
3 TraesCS1D01G258600 chrUn 260200261 260202560 2299 True 3773 3773 96.410 1 2285 1 chrUn.!!$R2 2284
4 TraesCS1D01G258600 chrUn 270905756 270908055 2299 True 3773 3773 96.410 1 2285 1 chrUn.!!$R3 2284
5 TraesCS1D01G258600 chrUn 282361902 282363529 1627 True 2676 2676 96.622 1 1600 1 chrUn.!!$R4 1599
6 TraesCS1D01G258600 chr4D 123424881 123427187 2306 False 3892 3892 97.269 1 2285 1 chr4D.!!$F1 2284
7 TraesCS1D01G258600 chr6B 596621490 596623803 2313 False 3880 3880 97.148 1 2285 1 chr6B.!!$F1 2284
8 TraesCS1D01G258600 chr3B 92319004 92321314 2310 False 3879 3879 97.144 1 2285 1 chr3B.!!$F1 2284
9 TraesCS1D01G258600 chr2B 30667138 30669446 2308 True 3838 3838 96.841 1 2285 1 chr2B.!!$R1 2284
10 TraesCS1D01G258600 chr7A 563584351 563586656 2305 False 3823 3823 96.749 1 2285 1 chr7A.!!$F1 2284
11 TraesCS1D01G258600 chr7B 742917873 742920174 2301 False 3803 3803 96.626 1 2285 1 chr7B.!!$F1 2284
12 TraesCS1D01G258600 chr4A 67573203 67575518 2315 True 3794 3794 96.464 1 2285 1 chr4A.!!$R1 2284
13 TraesCS1D01G258600 chr3D 154702220 154703793 1573 True 2545 2545 96.127 1 1549 1 chr3D.!!$R1 1548
14 TraesCS1D01G258600 chr7D 203543434 203544809 1375 True 2265 2265 96.657 1 1353 1 chr7D.!!$R1 1352

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
239 241 1.151899 AGGTGTGGGCTTACAGGGA 60.152 57.895 0.0 0.0 0.00 4.20 F
1012 1034 1.316266 AGGTAGATGCCTCCCAGCT 59.684 57.895 0.0 0.0 43.77 4.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1254 1299 0.743701 AGTCACGCCTAGACGACGAT 60.744 55.000 5.13 0.0 40.84 3.73 R
2262 2313 3.181405 ACAGAGTAAGAAGGAGGAAGGGT 60.181 47.826 0.00 0.0 0.00 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 3.439129 CAGTCGCCTATGATATACGGACA 59.561 47.826 0.00 0.0 0.00 4.02
239 241 1.151899 AGGTGTGGGCTTACAGGGA 60.152 57.895 0.00 0.0 0.00 4.20
473 491 5.586643 GGTTCTCCTACTTGATGGATGAAAC 59.413 44.000 0.00 0.0 0.00 2.78
484 502 6.258230 TGATGGATGAAACAACATGAGAAC 57.742 37.500 0.00 0.0 0.00 3.01
847 865 4.065088 TGTCATTGTCAGTCAACTAAGGC 58.935 43.478 0.00 0.0 38.97 4.35
987 1009 2.711009 TGGTGAACCTCTCCTTGTGATT 59.289 45.455 0.37 0.0 36.82 2.57
1012 1034 1.316266 AGGTAGATGCCTCCCAGCT 59.684 57.895 0.00 0.0 43.77 4.24
1075 1105 6.221659 CGACCTACAGTTCTCCTTAAACTTT 58.778 40.000 0.00 0.0 34.79 2.66
1213 1258 3.646715 CTTCGGGGACAAGGGGCA 61.647 66.667 0.00 0.0 0.00 5.36
1294 1339 6.012508 TGACTTCTTGTTTTGATCTCCCCTAT 60.013 38.462 0.00 0.0 0.00 2.57
1999 2050 2.608261 GCGGGAAGTCTAATCGGATCAG 60.608 54.545 0.00 0.0 0.00 2.90
2082 2133 2.562738 CCCACACCTTCATTCTTTTCCC 59.437 50.000 0.00 0.0 0.00 3.97
2134 2185 6.874278 TCACTCCAATCTTTCTCCATTAGA 57.126 37.500 0.00 0.0 0.00 2.10
2145 2196 6.998074 TCTTTCTCCATTAGAAACAAGAGCAA 59.002 34.615 0.00 0.0 46.88 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 5.163571 GCACAAACCCATTTTTGACCAATTT 60.164 36.000 2.70 0.0 38.54 1.82
324 326 3.244215 TGAGGTGCGAAGAGAAACATCTT 60.244 43.478 0.00 0.0 42.23 2.40
454 472 5.875224 TGTTGTTTCATCCATCAAGTAGGA 58.125 37.500 0.00 0.0 38.50 2.94
473 491 5.682943 TTTTAGAACCCGTTCTCATGTTG 57.317 39.130 13.21 0.0 46.13 3.33
484 502 7.619964 TTCTAGCCTTTTATTTTAGAACCCG 57.380 36.000 0.00 0.0 0.00 5.28
987 1009 3.977086 AGGCATCTACCTCATCCCA 57.023 52.632 0.00 0.0 33.62 4.37
1075 1105 2.159114 GCTTCTTTTCCACCAAGCACAA 60.159 45.455 0.00 0.0 40.86 3.33
1254 1299 0.743701 AGTCACGCCTAGACGACGAT 60.744 55.000 5.13 0.0 40.84 3.73
1294 1339 0.911769 CCCAGACAACATCCTAGGCA 59.088 55.000 2.96 0.0 0.00 4.75
1460 1511 6.488715 AGGGAGAGCAAGAAACTAAATCAAT 58.511 36.000 0.00 0.0 0.00 2.57
2082 2133 6.418057 AGTATGCTTTCTAAGATCAGAGGG 57.582 41.667 0.00 0.0 0.00 4.30
2134 2185 6.276847 CCGATAGATAGAGTTGCTCTTGTTT 58.723 40.000 3.87 0.0 39.34 2.83
2145 2196 3.527507 TCAAGGGCCGATAGATAGAGT 57.472 47.619 0.00 0.0 39.76 3.24
2262 2313 3.181405 ACAGAGTAAGAAGGAGGAAGGGT 60.181 47.826 0.00 0.0 0.00 4.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.